Spyridium bifidum

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Spyridium

At a glance

Occurrence records73

Data sources4

Biological traits15

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Spyridium bifidum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility73 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF73 records

DNA & barcodingNCBIsequences

01Narrative

Habit near Cleve, South Australia Spyridium bifidum, commonly known as forked spyridium, is a species of flowering plant in the family Rhamnaceae and is endemic to South Australia. It is an erect shrub with densely softly-hairy young stems, wedge-shaped to linear leaves sometimes with a two-lobed tip, and densely woolly heads of white-velvety flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology3

Fruit length3 mm

Leaf length8 mm

Leaf width4.5 mm

Life cycle & reproduction4

Dispersal typeanimal+self

Life spanperennial

Pollination syndromeinsect

Sex typehermaphrodite

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear obtriangular

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spyridium bifidum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOK481392.1 ↗6 278 bpAustralia

ACGT

TGTTGGCAGGCTCTGTGCTTGGGCATCGAACTGTTGACCTTCAGCTCCTTCAGTGGCTGCTACAAGGACTTGTGCTCCTTGAGGTGTTTT …

Spyridium bifidum subsp. wanillae voucher AD272790 external transcribed spacer, partial sequence; and 18S small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type73 records

Wild obs. + sensor41

Museum / vouchered32

Origin

Native43

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy28% within 1 km

≤100 m 2≤1 km 7≤10 km 23

32 georeferenced · 9 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 3≤1 km 6≤10 km 10>10 km 4

23 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	7
Mount Annan, AU	5
Adelaide, AU	5
Hobart, AU	4
Guangzhou, CN	3
Palmerston, AU	2
Parkville, AU	1
Kew, GB	1
MeiseBGlocation not on record	1
Armidale, AU	1
La Trobe Universitylocation not on record	1

11 institutions · 31 of 32 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)