Sprengelia sprengelioides

(R.Br.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Sprengelia

At a glance

Occurrence records825

Data sources7

Biological traits34

DNA specimens3

eDNA detections1

Sources7 archives

Databases and archives Sprengelia sprengelioides's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility825 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF825 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Sprengelia sprengelioides is a species of flowering plant of the family Ericaceae, and is endemic to near-coastal areas of eastern Australia. It is an erect shrub with egg-shaped leaves, and white flowers arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology10

Leaf length8 mm

Leaf mass per area73.4 g/m2

Leaf size24.84 mm²

Leaf width2.35 mm

Plant height0.65 m

Plant height max1 m

Plant height min0.3 m

Seed mass0.042 mg

⚠ sources differ — TRY: 0.042 mg · AusTraits: 0.049 mg · GIFT: 0.04 mg

Seed mass max0.04 mg

Seed mass min0.04 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Flowering endSep

Flowering startJun

Flowering timennnnnyyyynnn

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

⚠ sources differ — AusTraits: capsule · GIFT: nut

Growth formshrub

Leaf compoundnesssimple

Leaf shapeovate

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)13.9 mm²/mg

Wood density548 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sprengelia sprengelioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594362.1 ↗570 bpAustralia · 2018

ACGT

GGTGTTAAAGATTACAAATTGACTTATTATACTCCTAACTATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAAGTCCTCAA …

Sprengelia sprengelioides voucher 600300352 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Sprengelia sprengelioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-fedorov

CCDB · book-fedorov — Smith-White 1955

08Occurrence & distribution

Record type825 records

Wild obs. + sensor535

Museum / vouchered212

Cultivated / captive1

Other77

Origin

Native60

Range

Area of Occupancy AOO1 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 373≤1 km 67≤10 km 38>10 km 13

491 georeferenced · 44 without coordinates

Open the mapobservation + sensor535

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 29≤1 km 24≤10 km 86>10 km 42

181 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence212

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	80
Mount Annan, AU	60
Museo Entomologico de Leonlocation not on record	23
Canberra, AU	21
Armidale, AU	13
Hobart, AU	4
Beijing, CN	1
Zürich, CH	1
IPA/SPlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Auckland, NZ	1
University of the Sunshine Coastlocation not on record	1
Adelaide, AU	1
Smithfield, AU	1

14 institutions · 209 of 212 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Sprengelia sprengelioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.8–15.8

Seasonal swing summer↔winter9.00 °C

Max temp (day)19.2 °C

Min temp (night)12.8 °C

Precipitation54.7 mm/mo

Air humidity55.3 %

Moisture balance-49.7 mm/mo

Vapour deficit797 Pa

Wind speed5.00 m/s

Cloud cover26.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)