Sprengelia monticola

(DC.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Sprengelia

At a glance

Occurrence records353

Data sources4

Biological traits26

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Sprengelia monticola's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility353 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF353 records

DNA & barcodingNCBIsequences

01Narrative

Habit in the Blue Mountains National Park Sprengelia monticola, commonly known as rock sprengelia, is a species of flowering plant of the family Ericaceae, and is endemic to the Blue Mountains in eastern New South Wales. It is an open or low-lying shrub with egg-shaped to lance-shaped leaves, and white flowers arranged singly in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length5.75 mm

Leaf width2 mm

Plant height0.35 m

Plant height max0.5 m

Plant height min0.2 m

Seed mass0.01 mg

Seed mass max0.01 mg

Seed mass min0.01 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering endDec

Flowering startSep

Flowering timennnnnnnnyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sprengelia monticola has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM209411.1 ↗327 bpAustralia

ACGT

TACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAAGGCACGTCTGCCT …

Sprengelia monticola 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type353 records

Wild obs. + sensor228

Museum / vouchered124

Other1

Origin

Native42

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 117≤1 km 26≤10 km 11>10 km 4

158 georeferenced · 70 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 10≤1 km 36≤10 km 51>10 km 16

113 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence124

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	42
NSW Dept of Planning, Industry and Environmentlocation not on record	36
Canberra, AU	17
Museo Entomologico de Leonlocation not on record	14
Armidale, AU	7
Hobart, AU	3
Parkville, AU	2
Adelaide, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Brisbane, AU	1

10 institutions · 124 of 124 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)