Sporobolus virginicus
(L.) Kunth · speciesAt a glance
Occurrence records11 459
Data sources13
Biological traits130
DNA specimens7
eDNA detections7
Sources13 archives
Databases and archives Sporobolus virginicus's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 459 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources130 traits
Occurrence & distributionGBIF11 459 records
Environmental DNA1 datasets · 2 countries7 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB · GIFT2n = 20
01Narrative
Sporobolus virginicus, known by numerous common names including seashore dropseed, marine couch, sand couch, salt couch grass, saltwater couch, coastal rat-tail grass, and nioaka, is a species of grass with a wide distribution.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology21
Fruit length0.9 mm
Fruit length max1.2 mm
Fruit length min0.9 mm
Fruit width0.5 mm
Leaf length50 mm
Leaf length max140 mm
Leaf length min30 mm
Leaf mass89 mg
Leaf mass per area128 g/m2
Leaf size722 mm²
Leaf width2.5 mm
Leaf width max5 mm
Leaf width min2 mm
Plant height0.61 m
⚠ sources differ — GIFT: 0.61 m · AusTraits: 0.4 m · USDA: 0.61 m · TRY: 0.19 m
Plant height max0.76 m
Plant height min0 m
Seed length0.9 mm
Seed mass0.22 mg
⚠ sources differ — TRY: 0.22 mg · AusTraits: 0.179 mg · GIFT: 0.223 mg
Seed mass max0.22 mg
Seed mass min0.22 mg
Seed width1.5 mm
Life cycle & reproduction32
After harvest regrowth rateModerate
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — AusTraits: barochory · GIFT: zoochorous
Flower colourbrown
Flower conspicuousNo
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryLong
Pollination syndromeself+wind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Resprout abilityNo
Resprouting capacitypartial_resprouting
Seed spread rateSlow
Seedling vigorMedium
Sex typehermaphrodite
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment33
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterModerate
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
⚠ sources differ — AusTraits: caryopsis · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Growth form USDARhizomatous
Habitat GIFThalophytic vegetation
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionYes
Leaf shapelinear
Low growing grassYes
Mycorrhiza type0.000000000937
Root depth min18 in
Shape and orientationDecumbent
Small grainNo
Succulenceno
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min365 days
Leaf dry-matter content (LDMC)347 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Precipitation max40 in
Precipitation min20 in
Salinity toleranceHigh
Shade toleranceMedium
Soil pH max8 pH
Soil pH min6 pH
Temperature min17 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound2 000 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max16 000 per acre
Planting density min1 000 per acre
Shoot orientationerect
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporobolus virginicus has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes5
GenBank sequences10
eDNA detections7
Countries4
The DNA barcodea real sequence read deposited for this species
TTTTGAACGCAAGTTGCGCCTTAGGCCTCTTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCGAAGAGACACTCCCCTGCCAGCCACCCT …
Sporobolus virginicus isolate ZOTE_DP_2of3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Sporobolus virginicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records18–402n range20median20mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 183×CCDB · eflora · CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)
CCDB · eflora
CCDB · book-atlas-flowering-plants — Brown 1950
GIFT · GIFT (floras)
2n 203×CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-atlas-flowering-plants — E.K.J.*
GIFT · GIFT (floras)
2n 402×CCDB · ipcn-api-dl · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Smith-White, A. R. 1979. Polyploidy in Sporobolus virginicus (L.) Kunth. Austral. J. Bot. 27: 429–437.
GIFT · GIFT (floras)
2n 301×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 93×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2002. Chromosome studies on African plants. 18. The subfamily Chloridoideae. Bothalia 32(2): 240–249.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. II. An analysis of polyploidy. Taxon 52(4): 736–746.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. I. Basic chromosome numbers. Taxon 52(3): 557–566.
n 103×CCDB · book-ipcn72 · CCDB · book-ipcn75-78
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers, meiotic behavior, and notes on some grasses from Central America and the West Indies. Canad. J. Bot. 50: 1441-1452.
CCDB · book-ipcn75-78 — Davidse & Pohl 1978
CCDB · book-ipcn75-78 — Dujardin 1978
n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Smith-White, A. R. 1979. Polyploidy in Sporobolus virginicus (L.) Kunth. Austral. J. Bot. 27: 429–437.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
08Occurrence & distribution
Record type11 459 records
Wild obs. + sensor6 231
Museum / vouchered4 763
Other465
Origin
Native2 347
Introduced1
Range
Area of Occupancy AOO21 568 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy94% within 1 km
≤100 m 4 463≤1 km 765≤10 km 235>10 km 84
5 547 georeferenced · 684 without coordinates
Open the mapobservation + sensor6 231
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 604≤1 km 469≤10 km 835>10 km 204
2 112 georeferenced · 2 651 without coordinates
Open the institutions mapphysical evidence4 763
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions131 of 258 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| John T. Waterhouse Herbariumlocation not on record | 351 |
| Brisbane, AU | 297 |
| Adelaide, AU | 292 |
| Pretoria, ZA | 211 |
| Kensington, AU | 203 |
| Museo Entomologico de Leonlocation not on record | 179 |
| Saint Louis, US | 165 |
| Mount Annan, AU | 164 |
| Canberra, AU | 160 |
| University of Stellenboschlocation not on record | 160 |
| Durango, MX | 150 |
| Bronx, US | 117 |
| Taipei, TW | 91 |
| Kew, GB | 78 |
| Palmerston, AU | 74 |
| Cape Town, ZA | 69 |
| San Diego, US | 66 |
| Tampa, US | 57 |
| Mérida, MX | 51 |
| Puerto Ayora, EC | 46 |
| Hobart, AU | 43 |
| Durban, ZA | 40 |
| La Paz, MX | 39 |
| KMCClocation not on record | 37 |
| Mexico City, MX | 36 |
| Austin, US | 36 |
| Nishihara, JP | 33 |
| Xiamen, CN | 32 |
| Université de Strasbourglocation not on record | 31 |
| Jena Microbial Resource Collectionlocation not on record | 30 |
| UFESlocation not on record | 30 |
| BISHlocation not on record | 30 |
| Altos de Pipe, VE | 29 |
| Miami, US | 27 |
| Federal University of Espírito Santolocation not on record | 25 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| Salvador, BR | 21 |
| Smithfield, AU | 21 |
| Universidade Federal do Maranhãolocation not on record | 20 |
| MeiseBGlocation not on record | 20 |
| Honolulu, US | 20 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 19 |
| US | 19 |
| JBRJlocation not on record | 18 |
| Kagoshima, JP | 18 |
| QVMAGlocation not on record | 18 |
| IECOSlocation not on record | 16 |
| St. Augustine, TT | 16 |
| Paris, FR | 15 |
| Tsukuba, JP | 14 |
| Berlin, DE | 14 |
| UFBAlocation not on record | 12 |
| Mérida, MX | 12 |
| GAlocation not on record | 11 |
| LBVlocation not on record | 11 |
| Tapachula, MX | 11 |
| Masindi, UG | 11 |
| Bloomington, US | 11 |
| Chaguaramas, TT | 11 |
| LDlocation not on record | 10 |
| ASUlocation not on record | 10 |
| Armidale, AU | 10 |
| Beijing, CN | 10 |
| Wlocation not on record | 10 |
| J.F.Oberlin Universitylocation not on record | 10 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 9 |
| Herbier National du Gabonlocation not on record | 9 |
| Auckland, NZ | 9 |
| Riverside, US | 9 |
| Wuzhou, CN | 9 |
| TAIElocation not on record | 9 |
| The University of Arizonalocation not on record | 9 |
| UFERSAlocation not on record | 8 |
| Edinburgh, GB | 8 |
| Torreón, MX | 8 |
| Batemans Bay, AU | 8 |
| DanBIFlocation not on record | 8 |
| Aarhus, DK | 8 |
| EL PASO, US | 8 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 8 |
| Baroda, IN | 7 |
| Brasília, BR | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Instituto de Investigação Científica Tropicallocation not on record | 7 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 7 |
| MAlocation not on record | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 7 |
| WAGlocation not on record | 6 |
| Mississippi State, US | 6 |
| Universidade Federal do Espírito Santolocation not on record | 6 |
| Fort Worth, US | 6 |
| Stockholm, SE | 6 |
| Fortaleza, BR | 6 |
| Plocation not on record | 5 |
| Hermosillo, MX | 5 |
| Museu Paraense Emílio Goeldilocation not on record | 5 |
| CNF-UFHBlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Cape Town, ZA | 5 |
| Pondicherry, IN | 5 |
| Université de Bordeauxlocation not on record | 5 |
| Wollongong, AU | 5 |
| Laboratorio de Ictiologialocation not on record | 5 |
| Chicago, US | 5 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 5 |
| Columbia, US | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Montréal, CA | 5 |
| Forest Herbarium Ibadan (FHI)location not on record | 4 |
| Nishihara, JP | 4 |
| UnBlocation not on record | 4 |
| Guangzhou, CN | 4 |
| INMAlocation not on record | 4 |
| Wellington, NZ | 4 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 4 |
| Blumenau, BR | 4 |
| Seropédica, BR | 4 |
| Taipei, TW | 4 |
| Odawara, JP | 4 |
| Jackson, US | 4 |
| James Cook Townsvillelocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Université du Lomélocation not on record | 4 |
| UFRRJlocation not on record | 4 |
| BAYLUlocation not on record | 4 |
| Chengdu, CN | 4 |
| Claremont, US | 4 |
| Santa Teresa, BR | 4 |
| Universität Tübingenlocation not on record | 3 |
| UNESClocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| IPA/SPlocation not on record | 3 |
| Parkville, AU | 3 |
| Glocation not on record | 3 |
| Mexico City, MX | 3 |
| BGPAlocation not on record | 3 |
| Tuscaloosa, US | 3 |
| Conservatoire Botanique National de Mascarinlocation not on record | 3 |
| Culiacán, MX | 3 |
| Guangzhou, CN | 3 |
| GHPG$location not on record | 3 |
| HNBlocation not on record | 3 |
| Valdosta State Universitylocation not on record | 3 |
| UFPElocation not on record | 2 |
| Madison, US | 2 |
| UEPAlocation not on record | 2 |
| UFRPElocation not on record | 2 |
| Criciúma, BR | 2 |
| Brasília, BR | 2 |
| La Trobe Universitylocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Lubbock, US | 2 |
| San Francisco, US | 2 |
| Flagstaff, US | 2 |
| Chapingo, MX | 2 |
| Cenargenlocation not on record | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| CASlocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Nagano City, JP | 2 |
| Burlington, US | 2 |
| BRLUlocation not on record | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 2 |
| UEMAlocation not on record | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 2 |
| Ann Arbor, US | 2 |
| Calabar, NG | 2 |
| Foz do Iguaçu, BR | 1 |
| URCAlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Clemson, US | 1 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 1 |
| UNISANTAlocation not on record | 1 |
| Chadron, US | 1 |
| Davis, US | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Logan, US | 1 |
| Emporia, US | 1 |
| Helsinki, FI | 1 |
| Centre D'Etude sur les Ressources Végétaleslocation not on record | 1 |
| Yangling, CN | 1 |
| Zürich, CH | 1 |
| Shanxi Universitylocation not on record | 1 |
| León, NI | 1 |
| Elocation not on record | 1 |
| Ixtacuixtla de Mariano Matamoros, MX | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| GZUlocation not on record | 1 |
| National Tropical Botanical Gardenlocation not on record | 1 |
| UCAMlocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Sendai, JP | 1 |
| GB | 1 |
| Córdoba, AR | 1 |
| Cruz das Almas, BR | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| Tulane Universitylocation not on record | 1 |
| Irvine, US | 1 |
| Montpellier, FR | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| University of Patraslocation not on record | 1 |
| Turku, FI | 1 |
| Nanjing, CN | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Xining, CN | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Loja, EC | 1 |
| Toronto, CA | 1 |
| PRClocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| XALlocation not on record | 1 |
| Southern Illinois Universitylocation not on record | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Frankfurt am Main | 1 |
| Chapel Hill, US | 1 |
| San Isidro, AR | 1 |
| Moscow State Universitylocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| HCIBlocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Clocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| HAWlocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Monastir, TN | 1 |
| Ensenada, MX | 1 |
| Zapopan, MX | 1 |
| Denver, US | 1 |
| Juriquilla, MX | 1 |
| Cascavel, BR | 1 |
| Dehra Dun, IN | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Due West, US | 1 |
| Knoxville, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| ESALQlocation not on record | 1 |
| Kunming, CN | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Feira de Santana, BR | 1 |
| UTFPR-CPlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Sanda, JP | 1 |
| Bogotá, D.C., CO | 1 |
| UFSClocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| CPATSAlocation not on record | 1 |
258 institutions · 4 481 of 4 763 vouchered records shown · 281 without an institution code
09Environmental DNA7 detections
Where the DNA of Sporobolus virginicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.3 °C 15.0–21.7
Seasonal swing summer↔winter9.40 °C
Max temp (day)22.5 °C 20.9–24.1
Min temp (night)14.4 °C 9.80–19.0
Precipitation157 mm/mo 147–166
Air humidity63.2 % 59.7–66.6
Moisture balance22.1 mm/mo 8.60–35.7
Vapour deficit794 Pa 720–868
Wind speed3.30 m/s 2.60–4.00
Cloud cover25.2 % 21.7–28.7
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.