Sporobolus texanus

Vasey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sporobolus

At a glance

Occurrence records105

Data sources8

Biological traits10

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Sporobolus texanus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF105 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Sporobolus texanus is a species of grass known by the common name Texas dropseed. It is native to the western United States.Sporobolus texanus. NatureServe. This species is a perennial bunchgrass with fibrous roots. The stems grow 20 to long and may be erect or decumbent. The leaf blades are up to 18 cm long, but are generally shorter. The panicle is an open array of thin branches bearing tiny purplish spikelets.Sporobolus texanus. Grass Manual Treatment. This species is added to seed mixes for rangeland. It can tolerate saline and alkaline soils, such as those around oil well pads. It grows close to the ground and has fibrous roots, which help it bind the soil to reduce erosion. It provides good cover for small animals.Sporobolus texanus. USDA NRCS Plant Fact Sheet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporobolus texanus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM010510.1 ↗669 bpUSA

ACGT

ACCTGCGGAAGGATCATTGTCGTGACCCTAACAAAAATAGACTGTGAATATGTCACCCATGCCGTCGGGTGATGGTCCTTGCACCATCTC …

Sporobolus texanus voucher Churchill 2645 & Kaul (US) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type105 records

Wild obs. + sensor3

Museum / vouchered100

Other2

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 5≤1 km 10≤10 km 23>10 km 13

51 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	25
Bronx, US	14
Fort Worth, US	9
Musee des Dinosaures d'Esperaza (Aude)location not on record	6
Austin, US	6
Albuquerque, US	5
Emporia, US	4
Phoenix, US	3
EL PASO, US	3
Chadron, US	3
Riverside, US	3
Denver, US	3
Logan, US	2
Chongqing Museumlocation not on record	2
Flagstaff, US	2
Bloomington, US	2
Oskarshamn, SE	1
San Angelo, US	1
Tampa, US	1
Moscow, US	1
Taipei, TW	1
Durango, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
University of Stellenboschlocation not on record	1

24 institutions · 100 of 100 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Sporobolus texanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)