Sporobolus spicatus

(Vahl) Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sporobolus

At a glance

Occurrence records662

Data sources8

Biological traits23

DNA specimens17

eDNA detections7

Sources8 archives

Databases and archives Sporobolus spicatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF662 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI17 specimens

01Narrative

Sporobolus spicatus, also known as salt grass, is a halophyte.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.675 m

Plant height max1 m

Plant height min0.3 m

Seed mass0.146 mg

Seed mass max0.24 mg

Seed mass min0.07 mg

Life cycle & reproduction5

Flowering endApr

Flowering startApr

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 000 m

Elevation min5 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTgrassland and open bushland on slaine and alkaline soils of lake shores, flat plains, pans

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporobolus spicatus has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes5

GenBank sequences10

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX022104.1 ↗338 bpUnited Arab Emirates · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAGGCCTCTTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCTAA …

Sporobolus spicatus voucher FESH67 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type662 records

Wild obs. + sensor275

Museum / vouchered366

Cultivated / captive3

Other18

Range

Area of Occupancy AOO1 780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 28≤1 km 2≤10 km 6>10 km 3

39 georeferenced · 236 without coordinates

Open the mapobservation + sensor275

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 1≤1 km 9≤10 km 16>10 km 2

28 georeferenced · 338 without coordinates

Open the institutions mapphysical evidence366

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	83
Kew, GB	52
MeiseBGlocation not on record	29
Saint Louis, US	23
University of Stellenboschlocation not on record	21
Xiamen, CN	14
LDlocation not on record	11
Paris, FR	10
Adam Mickiewicz University in Poznańlocation not on record	8
Uniwersytet Śląski w Katowicachlocation not on record	8
Edinburgh, GB	7
TAFORI-LSRClocation not on record	6
GZUlocation not on record	5
Berlin, DE	5
Forest Herbarium Ibadan (FHI)location not on record	3
Sharjah Research Academy, Seed Bank and Herbariumlocation not on record	3
Uppsala, SE	3
Pondicherry, IN	3
BClocation not on record	3
Cape Town, ZA	2
Instituto de Investigação Científica Tropicallocation not on record	2
Natural History Museum Rotterdamlocation not on record	2
Wlocation not on record	2
Frankfurt am Main	2
Olocation not on record	2
National Museums of Kenyalocation not on record	2
Bronx, US	1
Yaoundé, CM	1
Stockholm, SE	1
IPA/SPlocation not on record	1
Badajoz, ES	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Moscow State Universitylocation not on record	1
Durban, ZA	1
South African National Biodiversity Institutelocation not on record	1
Sharjah Seed Bank & Herbariumlocation not on record	1
PRClocation not on record	1
Baroda, IN	1
Arusha, TZ	1

39 institutions · 324 of 366 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Sporobolus spicatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.1 °C 21.8–30.8

Seasonal swing summer↔winter16.4 °C

Max temp (day)31.2 °C 26.7–35.4

Min temp (night)26.2 °C 16.6–26.8

Precipitation3.00 mm/mo 2.00–83.2

Air humidity56.8 % 37.0–58.6

Moisture balance-51.2 mm/mo

Vapour deficit1,721 Pa 1,106–2,798

Wind speed1.90 m/s

Cloud cover15.1 % 15.0–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)