Sporobolus natalensis

(Steud.) T.Durand & Schinz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sporobolus

At a glance

Occurrence records941

Data sources7

Biological traits33

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Sporobolus natalensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility941 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF941 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Sporobolus natalensis là một loài thực vật có hoa trong họ Hòa thảo. Loài này được (Steud.) T.Durand & Schinz miêu tả khoa học đầu tiên năm 1894.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length0.75 mm

Fruit width0.6 mm

Leaf length375 mm

Leaf length max0.4 mm

Leaf size675 mm²

Leaf width3 mm

Leaf width max4 mm

Leaf width min2 mm

Plant height1.5 m

⚠ sources differ — AusTraits: 1.5 m · TRY: 1.2 m

Plant height max1.5 m

Seed mass0.21 mg

Seed mass max0.21 mg

Seed mass min0.21 mg

Life cycle & reproduction6

Dispersal typeself

Life formperennial

Life spanperennial

Pollination syndromewind

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 800 m

Elevation min400 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: tussock · TRY: Herb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporobolus natalensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU646095.1 ↗645 bp

ACGT

GAACCTGCGGAAGGATCATTGTCGTGACCCTAACCAAAATAGACTGTGAACATGTCATCAATTCCACCGGGTGATGGCCATAGTGTCGTC …

Sporobolus natalensis clone 5 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type941 records

Wild obs. + sensor595

Museum / vouchered322

Cultivated / captive1

Other23

Origin

Native17

Introduced7

Range

Area of Occupancy AOO1 460 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 588≤1 km 3>10 km 1

592 georeferenced · 3 without coordinates

Open the mapobservation + sensor595

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 109≤1 km 14≤10 km 70>10 km 22

215 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence322

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	159
Pretoria, ZA	68
Mount Annan, AU	18
Canberra, AU	16
Kew, GB	13
Smithfield, AU	12
Palmerston, AU	7
Cape Town, ZA	5
Saint Louis, US	5
Yaoundé, CM	4
James Cook Townsvillelocation not on record	4
Museo Entomologico de Leonlocation not on record	4
Durban, ZA	1
Hobart, AU	1
South African National Biodiversity Institutelocation not on record	1
Adelaide, AU	1

16 institutions · 319 of 322 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Sporobolus natalensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter10.8 °C

Max temp (day)28.6 °C

Min temp (night)17.9 °C

Precipitation51.0 mm/mo

Air humidity54.1 %

Moisture balance-104 mm/mo

Vapour deficit1,346 Pa

Wind speed3.30 m/s

Cloud cover33.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)