Sporobolus indicus
(L.) R.Br. · speciesAt a glance
Occurrence records29 525
Data sources13
Biological traits43
DNA specimens14
eDNA detections11
Sources13 archives
Databases and archives Sporobolus indicus's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility29 504 records↗
OBISOcean Biodiversity Information System21 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics14 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources43 traits
Occurrence & distributionGBIF · OBIS29 525 records
Environmental DNA1 datasets · 4 countries11 detections
DNA & barcodingBOLD · NCBI14 specimens
Genome at a glanceCCDB2n = 36
01Narrative
Sporobolus indicus is a species of grass known by the common name smut grass.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology15
Inflorescence length max30 cm
Inflorescence length min10 cm
Leaf length max300 mm
Leaf length min100 mm
Leaf width max5 mm
Leaf width min1 mm
Plant height0.8 m
⚠ sources differ — GIFT: 0.8 m · TRY: 0.234 m
Plant height max1 m
Plant height min0.3 m
Seed mass0.2 mg
⚠ sources differ — TRY: 0.2 mg · GIFT: 0.138 mg
Seed mass max0.215 mg
Seed mass min0.1 mg
Seed volume0.12 mm³
Seed volume max0.12 mm³
Seed volume min0.12 mm³
Life cycle & reproduction11
Deciduousnessevergreen
Dispersal type detailedanthropochorous
Flower length max2 mm
Flower length min1.4 mm
Flowering endApr
Flowering startMar
Life formannual or perennial
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Cerrado (lato sensu), Floresta de Terra Firme, Floresta Ombrófila (= Floresta Pluvial), Restinga, Savana Amazônica
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Other traits2
Inflorescencepanicle
Shoot orientationerect
05DNA & barcoding14 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporobolus indicus has left across the world's sequence archives.
At a glance
DNA specimens14
Marker genes6
GenBank sequences10
eDNA detections11
Countries5
The DNA barcodea real sequence read deposited for this species
AGGTGACCTGCGGAGGATCATTGTCGTGACCCTAACCAAAATAGACTGTGAACATGTCATCAATTCCACCGGGTGATGGCCATAGTGTCG …
Sporobolus indicus var. pyramidalis voucher 150834 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Sporobolus indicus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records24–402n range36median36mode14records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3611×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +3
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). I. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 29-66(1990).
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · ipcn-api-dl — Queirós, M. & J. Ormonde. 1984. Contribução para o conhecimento citotaxonómico da florados Açores - I. Bol. Soc. Brot. 57: 77–85.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, R. Tormo, A. Muñoz, M. C. Viera, J. Carrasco, A. Ortega & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., sér. 2 63: 153–205.
CCDB · ipcn-api-dl — Petrova, A. & K. Stoyanova. 1998. Mediterranean chromosome number reports 8 (941--960). Fl. Medit. 8: 251–262.
CCDB · book-ipcn73-74 — KOZUHAROV, S., & A.V. PETROVA. 1974. Cytotaxonomic study on Poaceae VI. Coneptes rend. Acad. Bulg. Sci. 27: 961-964.
CCDB · Cave1962 — Tateoka 1962
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
CCDB · CromoCat 2015 — Devesa, J.A., Ruiz, T., Tormo, R., Muñoz, A., Viera, M. C., Carrasco, J., Ortega, A. & Pastor, J. (1990). Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., Sér. 2 63:153-205
CCDB · CromoCat 2015 — Petrova, A. & K. Stoyanova. (1998). Mediterranean chromosome number reports-8. Fl. Medit. 8: 251-262.
CCDB · CromoCat 2015 — Queirós, M. & J. Ormonde. (1984). Contribuiçao para o conhecimiento citotaxonómico da flora dos Açores. I. Bol. Soc. Brot. 57: 77-85.
2n 242×CCDB · book-ipcn65 · CCDB · book-atlas-flowering-plants
CCDB · book-ipcn65 — Gould 1965
CCDB · book-atlas-flowering-plants — Warmke et al. 1946
2n 401×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
n 187×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bir, S. S., M. Sahni & C. P. Singh. 1988. Cytology of genus Sporobolus R. Br. from north India (Punjab Plain). Cytologia 53: 53–57.
CCDB · ipcn-api-dl — Sahni, M. & S. S. Bir. 1985. SOCGI plant chromosome number reports -- III. J. Cytol. Genet. 20: 205–206.
CCDB · ipcn-api-dl — Bir, S. S., M. Sahni & C. P. Singh. 1987. Cytology of genus Sporobolus R. Br. from north India (Punjab Plain). Proc. Indian Sci. Congr. Assoc. 74(3,VI): 185–186.
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers, meiotic behavior, and notes on some grasses from Central America and the West Indies. Canad. J. Bot. 50: 1441-1452.
CCDB · CromoCat 2015 — Bir, S. S., Sahni, M. & Singh, C. P. (1987). Cytology of genus Sporobolus R. Br. from north India (Punjab Plain) Proceedings of the Indian Science Congress Association 74(3,VI): 185-186
CCDB · CromoCat 2015 — Bir, S. S., Sahni, M. & Singh, C. P. (1988). Cytology of genus Sporobolus R. Br. from north India (Punjab Plain) Cytologia 53: 53-57
CCDB · CromoCat 2015 — Sahni, M. & S.S. Bir. (1985). SOCGI plant chromosome number reports -- III. Journal of Cytology and Genetics 20: 205-206
n 242×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — MEHRA, P.N., & V. KALIA. 1974. In IOPB chromosome number reports XLVI Taxon 23: 801-812.
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~0.7 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.7 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type29 525 records
Wild obs. + sensor24 468
Museum / vouchered4 550
Cultivated / captive1
Other506
Origin
Native294
Introduced25
Range
Area of Occupancy AOO49 168 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy22% within 1 km
≤100 m 2 617≤1 km 696≤10 km 11 206>10 km 227
14 746 georeferenced · 9 722 without coordinates
Open the mapobservation + sensor24 468
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 1 045≤1 km 243≤10 km 358>10 km 77
1 723 georeferenced · 2 827 without coordinates
Open the institutions mapphysical evidence4 550
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions172 of 342 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 347 |
| Mexico City, MX | 306 |
| University of Stellenboschlocation not on record | 282 |
| Durango, MX | 264 |
| Bronx, US | 140 |
| Austin, US | 105 |
| Xiamen, CN | 101 |
| San Isidro, AR | 99 |
| BIO-UNIPIlocation not on record | 96 |
| BDBClocation not on record | 86 |
| Mexico City, MX | 77 |
| Córdoba, AR | 77 |
| Guasave, MX | 67 |
| Tampa, US | 63 |
| National Biodiversity Institute, Costa Ricalocation not on record | 61 |
| Kew, GB | 58 |
| Jena Microbial Resource Collectionlocation not on record | 57 |
| Ciudad Autónoma de Buenos Aires, AR | 51 |
| BClocation not on record | 47 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 46 |
| Aarhus, DK | 43 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 41 |
| Barcelona, ES | 38 |
| Canadian Department of Agriculturelocation not on record | 34 |
| Davis, US | 34 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 34 |
| Université de Bordeauxlocation not on record | 33 |
| Bloomington, US | 33 |
| Miami, US | 32 |
| Chapingo, MX | 30 |
| Ann Arbor, US | 28 |
| UFMSlocation not on record | 27 |
| Ixtacuixtla de Mariano Matamoros, MX | 24 |
| MAlocation not on record | 24 |
| CICYTEXlocation not on record | 23 |
| PUC-RSlocation not on record | 23 |
| Riverside, US | 23 |
| Juriquilla, MX | 22 |
| Zacatecas, MX | 21 |
| St. Augustine, TT | 21 |
| Puerto Ayora, EC | 21 |
| US | 21 |
| Antiguo Cuscatlán, SV | 21 |
| Castelar, AR | 20 |
| Fort Worth, US | 20 |
| UNIVASFlocation not on record | 19 |
| València, ES | 17 |
| Wuzhou, CN | 17 |
| Chapel Hill, US | 17 |
| Tuxtla Gutiérrez, MX | 17 |
| Taipei, TW | 16 |
| Corrientes, AR | 16 |
| San Diego, US | 16 |
| UFSClocation not on record | 16 |
| Universidade Federale do Rio Grande do Sullocation not on record | 15 |
| Williamsburg, US | 15 |
| KURAlocation not on record | 15 |
| Berlin, DE | 15 |
| Jackson, US | 15 |
| Autlán de Navarro, MX | 14 |
| Blumenau, BR | 14 |
| UFMGlocation not on record | 14 |
| Honolulu, US | 14 |
| Brasília, BR | 14 |
| KMCClocation not on record | 14 |
| Universidade Federal do Maranhãolocation not on record | 14 |
| Entomological Society of Latvialocation not on record | 14 |
| Fundación Miguel Lillolocation not on record | 14 |
| Chongqing Museumlocation not on record | 13 |
| Laboratorio de Ictiologialocation not on record | 13 |
| Knoxville, US | 13 |
| Austin, US | 12 |
| Puebla, MX | 12 |
| Universidad de Caldas (UCaldas)location not on record | 12 |
| Tuscaloosa, US | 12 |
| Auckland, NZ | 11 |
| Olocation not on record | 11 |
| Toluca, MX | 11 |
| Salvador, BR | 11 |
| Claremont, US | 11 |
| Santa Barbara, US | 11 |
| MeiseBGlocation not on record | 10 |
| Montecillo, Texcoco, MX | 10 |
| Salamanca, ES | 10 |
| Vitoria, ES | 10 |
| LDlocation not on record | 10 |
| GAlocation not on record | 10 |
| EL PASO, US | 9 |
| Baroda, IN | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| Valdosta State Universitylocation not on record | 9 |
| BAYLUlocation not on record | 9 |
| Flagstaff, US | 9 |
| UNESClocation not on record | 9 |
| Mexico City, MX | 9 |
| Columbia, US | 9 |
| Paleontological Collectionlocation not on record | 8 |
| Zürich, CH | 8 |
| CJBGlocation not on record | 8 |
| TLAXlocation not on record | 8 |
| Badajoz, ES | 8 |
| Paris, FR | 8 |
| San José, CR | 8 |
| Pelotas, BR | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Ciudad de México, MX | 7 |
| California Academy of Scienceslocation not on record | 7 |
| FUVATESlocation not on record | 7 |
| Departamento de Sistematica e Ecologialocation not on record | 7 |
| Feira de Santana, BR | 7 |
| ASUlocation not on record | 7 |
| Chengdu, CN | 7 |
| JBRJlocation not on record | 7 |
| UnBlocation not on record | 7 |
| CASlocation not on record | 7 |
| Santa Cruz de la Sierra, BO | 7 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Masindi, UG | 7 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| AUAlocation not on record | 7 |
| Université de Strasbourglocation not on record | 6 |
| Criciúma, BR | 6 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 6 |
| Wlocation not on record | 6 |
| UFESlocation not on record | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| The University of Arizonalocation not on record | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Universidad Nacional del Litorallocation not on record | 5 |
| UEMlocation not on record | 5 |
| UNICAMPlocation not on record | 5 |
| Linares, MX | 5 |
| MEXUlocation not on record | 5 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 5 |
| BISHlocation not on record | 5 |
| Dover, US | 5 |
| Cambridge, US | 5 |
| UFPElocation not on record | 5 |
| Quito, EC | 5 |
| Universidade Federal de Pelotaslocation not on record | 5 |
| UFBAlocation not on record | 5 |
| Córdoba, ES | 5 |
| Dresden, DE | 4 |
| Fairfax, US | 4 |
| Madrid, ES | 4 |
| Moscow State Universitylocation not on record | 4 |
| UNESP, Campus São José Rio Prêtolocation not on record | 4 |
| South Kensington, GB | 4 |
| Logan, US | 4 |
| Norfolk, US | 4 |
| Ciudad de México, MX | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 4 |
| Chicago, US | 4 |
| Wellington, NZ | 4 |
| Loja, EC | 4 |
| Burlington, US | 4 |
| UFRPElocation not on record | 4 |
| DanBIFlocation not on record | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Tapachula, MX | 4 |
| La Paz, BO | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Brussel, BE | 3 |
| Pretoria, ZA | 3 |
| Provincia di Livornolocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Granada, ES | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| US | 3 |
| Alicante, ES | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Northridge, US | 3 |
| Tlalnepantla, MX | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| Pittsburg, US | 3 |
| Lake Charles, US | 3 |
| UEMAlocation not on record | 2 |
| Durham, US | 2 |
| UDESC-CAVlocation not on record | 2 |
| Lausanne, CH | 2 |
| MCNAMlocation not on record | 2 |
| UNESP-ISlocation not on record | 2 |
| CEPLAClocation not on record | 2 |
| Chaguaramas, TT | 2 |
| UNESP-FCAlocation not on record | 2 |
| Santa Maria, BR | 2 |
| San Angelo, US | 2 |
| Frankfurt am Main | 2 |
| Johnson City, US | 2 |
| San Luis Potosí, MX | 2 |
| Gijón, ES | 2 |
| PRClocation not on record | 2 |
| Cusco, PE | 2 |
| Tempe, US | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Shanghai, CN | 2 |
| Nanjing, CN | 2 |
| Pamplona, ES | 2 |
| Millersville, US | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Montréal, CA | 2 |
| Stockholm, SE | 2 |
| Bangkok, TH | 2 |
| Seropédica, BR | 2 |
| Mérida, MX | 2 |
| HUENFlocation not on record | 2 |
| Santarém, BR | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| UFRRJlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| Beijing, CN | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Cuiabá, BR | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Clemson, US | 2 |
| GB | 2 |
| Federal University of Espírito Santolocation not on record | 1 |
| Universidad de la Republica, Facultad de Agronomia, Bernardo Rosengurtt Herbariumlocation not on record | 1 |
| Banyoles, ES | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| San Francisco, US | 1 |
| Anchorage, US | 1 |
| La Paz, MX | 1 |
| Colgate Universitylocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Whitehorse, CA | 1 |
| Salzburg, AT | 1 |
| BFLlocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| MVFAlocation not on record | 1 |
| Little Rock, US | 1 |
| Awka, NG | 1 |
| Culiacán, MX | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Lanzhou, CN | 1 |
| Rishon Le Zion, IL | 1 |
| Bourges, FR | 1 |
| QCNElocation not on record | 1 |
| Albuquerque, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Zürich, CH | 1 |
| Hermosillo, MX | 1 |
| CUVClocation not on record | 1 |
| BAlocation not on record | 1 |
| Edmonton, CA | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| León, NI | 1 |
| TAIElocation not on record | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| Sucre, BO | 1 |
| IPA/SPlocation not on record | 1 |
| UERJlocation not on record | 1 |
| Llocation not on record | 1 |
| Cochabamba, BO | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Morelia, MX | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Madison, US | 1 |
| San Francisco de Campeche, MX | 1 |
| Lincoln, US | 1 |
| UFOPlocation not on record | 1 |
| Wuhan, CN | 1 |
| CJBNlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Guangzhou, CN | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Fayetteville, US | 1 |
| INMAlocation not on record | 1 |
| Los Angeles, US | 1 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| BMlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Londrina, BR | 1 |
| Mlocation not on record | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Sangmiung Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Cascavel, BR | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Glocation not on record | 1 |
| FAGRO - UDELARlocation not on record | 1 |
| Pullman, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Mount Pleasant, US | 1 |
| OTSlocation not on record | 1 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 1 |
| New Mexico State Universitylocation not on record | 1 |
| East Lansing, US | 1 |
| UTFPR-CPlocation not on record | 1 |
| Christchurch, NZ | 1 |
| UNESP-RClocation not on record | 1 |
| Dekalb, US | 1 |
| TNMlocation not on record | 1 |
| Pamplona, ES | 1 |
| IPHAMETRAlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Uppsala, SE | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Ilhéus, BR | 1 |
| WTUlocation not on record | 1 |
| Jaén, ES | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Pondicherry, IN | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| GJOlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Bern, CH | 1 |
| Russellville, US | 1 |
| University of California at Berkeleylocation not on record | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Columbus State Universitylocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Altos de Pipe, VE | 1 |
| McWane Science Centerlocation not on record | 1 |
342 institutions · 4 417 of 4 550 vouchered records shown · 109 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Sporobolus indicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.8 °C 15.0–25.9
Seasonal swing summer↔winter9.60 °C
Max temp (day)22.0 °C 20.3–30.3
Min temp (night)12.7 °C 9.00–22.6
Precipitation73.5 mm/mo 18.4–166
Air humidity62.1 % 50.9–64.2
Moisture balance-51.5 mm/mo -113–41.3
Vapour deficit884 Pa 695–1,202
Wind speed3.00 m/s 1.10–4.10
Cloud cover27.6 % 20.6–40.4
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.