Sporobolus floridanus

Chapm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Sporobolus

At a glance

Occurrence records123

Data sources4

Biological traits11

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Sporobolus floridanus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility123 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF123 records

DNA & barcodingNCBIsequences

01Narrative

Sporobolus floridanus là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Chapm. miêu tả khoa học đầu tiên năm 1860.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass1.11 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporobolus floridanus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLKJ773927.1 ↗1 190 bp

ACGT

TCTTGGCAGCATTCCGAGTAACTCCTCAGCCCGGGGTTCCGCCTGAAGAAGCAGGGGCTGCAGTAGCTGCGGAATCTTCTACTGGTACAT …

Sporobolus floridanus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type123 records

Wild obs. + sensor23

Museum / vouchered100

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1>10 km 4

14 georeferenced · 9 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 3≤1 km 4≤10 km 5>10 km 4

16 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	26
Tampa, US	20
Valdosta State Universitylocation not on record	14
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Bronx, US	4
GAlocation not on record	3
Wuzhou, CN	3
Miami, US	3
Claremont, US	2
Tall Timbers Research Stationlocation not on record	2
Saint Louis, US	2
Auckland, NZ	2
Jackson, US	2
University of North Carolina at Pembrokelocation not on record	1
Chapel Hill, US	1
Logan, US	1
Wlocation not on record	1

17 institutions · 98 of 100 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)