Sporisorium scitamineum

(Syd.) M.Piepenbr., M.Stoll & Oberw. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Ustilaginomycetes/Ustilaginales/Ustilaginaceae/Sporisorium

At a glance

Occurrence records73

Data sources9

Biological traits0

DNA specimens47

eDNA detections59

Sources9 archives

Databases and archives Sporisorium scitamineum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF73 records

Environmental DNA5 datasets · 5 countries59 detections

DNA & barcodingBOLD · NCBI47 specimens

Genome at a glanceGoaT · NCBI≈20 Mbp

01Narrative

Sugarcane smut is a fungal disease of sugarcane caused by the fungus Sporisorium scitamineum. The disease is known as culmicolous, which describes the outgrowth of fungus of the stalk on the cane. It attacks several sugarcane species and has been reported to occur on a few other grass species as well, but not to a critical amount. The most recognizable characteristic of this disease is a black or gray growth that is referred to as a "smut whip".Comstock, J. C. and Lentini, R. S. Sugarcane Smut Disease, University of Florida. Resistance to sugarcane smut is the best course of action for management, but also the use of disease free seed is important. On smaller scale operations treatments using hot water and removing infected plants can be effective. The main mode of spore dispersal is the wind but the disease also spreads through the use of infected cuttings. Sugarcane smut is a devastating disease in sugarcane growing areas globally."Information Sheet ISO6052." BSES Sugarcane for the Future. Queensland Government: Department of Primary Industries and Fisheries, 2006. Web. 5 Oct. 2011. <

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporisorium scitamineum has left across the world's sequence archives.

At a glance

DNA specimens47

Marker genes2

GenBank sequences10

eDNA detections59

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPX106483.1 ↗278 bpIndia · 2024

ACGT

CAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAAGTGAATCATCGAATCTTTGA …

Sporisorium scitamineum isolate Lk7 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sporisorium scitamineum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈19 998 869 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Sporisorium scitamineum0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness98.5% BUSCO

07Deep time~26 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin26 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type73 records

Museum / vouchered73

Range

Area of Occupancy AOO120 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 73 records without

Open the institutions mapphysical evidence73

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	8
Kensington, AU	1
WU-MYClocation not on record	1

3 institutions · 10 of 73 vouchered records shown · 57 without an institution code

09Environmental DNA59 detections

Where the DNA of Sporisorium scitamineum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found59

Studies independent surveys5

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 59 detections have coordinates

Open the map5 countries0

marine macroalgae

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.10 4.60–6.20

Conductivity57.0 µS/cm 42.0–58.0

Organic carbon0.84 % 0.47–0.97

Water content11.6 % 10.4–12.2

Nitrate-N10.0 mg/kg 5.00–11.0

Phosphorus175 mg/kg 39.0–189

Clay14.3 % 10.1–16.0

Sand55.7 % 54.8–80.7

Depth0 m 0–0.2

SoilVertosolSodosol

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 19.9–28.5

Seasonal swing summer↔winter5.10 °C

Max temp (day)33.7 °C 25.3–36.2

Min temp (night)19.2 °C 13.0–22.6

Precipitation13.8 mm/mo 2.90–162

Air humidity48.2 % 41.9–63.2

Moisture balance-147 mm/mo -160–-8.30

Vapour deficit1,643 Pa 878–2,206

Wind speed2.60 m/s 1.60–3.30

Cloud cover18.5 % 13.4–28.1

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)