Sporadanthus ferrugineus

de Lange, Heenan & B.D.Clarkson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Restionaceae/Sporadanthus

At a glance

Occurrence records105

Data sources8

Biological traits30

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Sporadanthus ferrugineus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Occurrence & distributionGBIF105 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Sporadanthus ferrugineus là một loài thực vật có hoa trong họ Restionaceae. Loài này được de Lange, Heenan & B.D.Clarkson miêu tả khoa học đầu tiên năm 1999.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length2 mm

Fruit width2 mm

Plant height3 m

Plant height max5 m

Seed length0.8 mm

Seed length max0.8 mm

Seed length min0.8 mm

Seed mass0.267 mg

Seed width0.6 mm

Seed width max0.6 mm

Seed width min0.6 mm

Life cycle & reproduction9

Deciduousnessn.d.

⚠ sources differ — TRY: n.d. · GIFT: evergreen

Dispersal type detailedanemochorous

Life formrhizomatous geophyte

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formcryptophyte

Reproduction asexualpresent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sporadanthus ferrugineus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLGQ130336.1 ↗1 337 bpNew Zealand

ACGT

ACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATC …

Sporadanthus ferrugineus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Sporadanthus ferrugineus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Murray, B. G. & P. J. d. Lange. 1999. Contributions to a chromosome atlas of the New Zealand flora---35. Miscellaneous families. New Zealand J. Bot. 37: 511–521.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type105 records

Wild obs. + sensor21

Museum / vouchered84

Origin

Native3

Range

Area of Occupancy AOO148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 9≤1 km 1≤10 km 3>10 km 1

14 georeferenced · 7 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	52
Wellington, NZ	22
Rotorua, NZ	4
Mount Annan, AU	3
Kew, GB	2

5 institutions · 83 of 84 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Sporadanthus ferrugineus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)