Splanchnonema platani — The Life Data

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Pleomassariaceae/Splanchnonema

At a glance

Occurrence records107

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Splanchnonema platani's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility107 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF107 records

DNA & barcodingNCBIsequences

01Narrative

Splanchnonema platani is a fungus in the genus Splanchnonema. It was formerly known under the name Massaria platani. The anamorph of the fungus is known as Macrodiplodiopsis desmazieresii. The fungus has caused serious damage to plane trees across Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Splanchnonema platani has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKR909311.1 ↗586 bp

ACGT

ATCATTAAATGGCCCAACACCCTCGGTCGCCCCCAGGCGTTCCGTTGCTGAGTGCTGGTCCGCACATGCCTCGTGTCAGTACGCACGCGA …

Splanchnonema platani strain CBS 222.37 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS6

fungal barcode

08Occurrence & distribution

Record type107 records

Wild obs. + sensor51

Museum / vouchered56

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 3≤1 km 1≤10 km 42

46 georeferenced · 5 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤1 km 2≤10 km 8>10 km 1

11 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	32
Bronx, US	6
WU-MYClocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Gijón, ES	1
Zürich, CH	1
Kew, GB	1
Auckland, NZ	1

8 institutions · 49 of 56 vouchered records shown · 7 without an institution code