Spirodela oligorrhiza — The Life Data

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Spirodela

At a glance

Occurrence records30

Data sources6

Biological traits15

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Spirodela oligorrhiza's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF30 records

DNA & barcodingNCBIsequences

01Narrative

Spirodela oligorrhiza is a species of plants in the family Araceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length5 mm

Leaf length max6 mm

Leaf length min4 mm

Leaf width2 mm

Leaf width max2.5 mm

Leaf width min1.5 mm

Life cycle & reproduction2

Life formhydroannual

Lifeform raunkiaer detailedhydrophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTwetland vegetation

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Spirodela oligorrhiza across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavones1

Documented compounds1 total

Compound	Class	Amount	Source
Flavonoid LP		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spirodela oligorrhiza has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMF349577.1 ↗553 bpUSA · 2015

ACGT

AAGTGCTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGAGTATGAGACAAAAGATACGGATATCTTGGCAGC …

Spirodela oligorrhiza isolate AD3HK56 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1

plant barcode

08Occurrence & distribution

Record type30 records

Museum / vouchered30

Range

Area of Occupancy AOO100 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 7

7 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence30

10Collections & institutions

Holding institutions11 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Osaka, JP	7
Odawara, JP	5
Norfolk, US	4
University of Stellenboschlocation not on record	4
Saint Louis, US	3
Kunming, CN	1
Millersville, US	1
US	1
Riverside, US	1
Corvallis, US	1
Williamsburg, US	1
San Luis Obispo, US	1

12 institutions · 30 of 30 vouchered records shown