Spiranthes sylvatica — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Spiranthes

At a glance

Occurrence records116

Data sources5

Biological traits3

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Spiranthes sylvatica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility116 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF116 records

DNA & barcodingNCBIsequences

01Narrative

Spiranthes sylvatica, the woodland ladies' tresses or pale-green ladies'-tresses is a terrestrial orchid endemic to the United States, very similar in appearance and range to Spiranthes praecox which it had been considered a variation of for a long time.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formtuberous geophyte

Habitat & environment1

Climatetemperate

Other traits1

Plant support typefree-standing

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiranthes sylvatica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU384871.1 ↗632 bpUSA

ACGT

CCCGTGGACATGTGGCAGCGTCAGCTGCCTGTAAATGCCATTCGCCCGGTGCCCCCTTCTCGATCGGAGCATCAAAATGGGTGGATGCAA …

Spiranthes sylvatica voucher NYBG:25d internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type116 records

Wild obs. + sensor93

Museum / vouchered23

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 30≤1 km 2>10 km 49

81 georeferenced · 12 without coordinates

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤1 km 1≤10 km 5

10 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valdosta State Universitylocation not on record	7
Jena Microbial Resource Collectionlocation not on record	6
Chapel Hill, US	5
Bronx, US	3
GAlocation not on record	1
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	1

6 institutions · 23 of 23 vouchered records shown