Spiranthes longilabris

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Spiranthes

At a glance

Occurrence records181

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Spiranthes longilabris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility181 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF181 records

DNA & barcodingNCBIsequences

01Narrative

Spiranthes longilabris, the Long Lipped Ladies' Tresses is an orchid endemic to the southeastern United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or tuberous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiranthes longilabris has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM262317.1 ↗644 bpUSA

ACGT

GATGACCCTTGATAACCCGTGGACATGTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCGATCGGGGCATCAG …

Spiranthes longilabris isolate 13d internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★ITS4

plant barcodefungal barcode

08Occurrence & distribution

Record type181 records

Wild obs. + sensor120

Museum / vouchered61

Range

Area of Occupancy AOO616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 120

120 georeferenced

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 8≤10 km 11>10 km 18

37 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence61

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	10
Chicago, US	9
Miami, US	7
Bronx, US	5
Jena Microbial Resource Collectionlocation not on record	5
Philadelphia, US	5
South Kensington, GB	4
Austin, US	3
Chongqing Museumlocation not on record	2
Madison, US	2
Wuzhou, CN	1
Millersville, US	1
Tall Timbers Research Stationlocation not on record	1
Chapel Hill, US	1
Tampa, US	1
Columbia, US	1
BAYLUlocation not on record	1
Bozeman, US	1

18 institutions · 60 of 61 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)