Spiranthes incurva

(Jenn.) M.C.Pace · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Spiranthes

At a glance

Occurrence records2 407

Data sources6

Biological traits3

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Spiranthes incurva's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF2 407 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Spiranthes incurva, the Sphinx ladies' tresses, is a species of flowering plant in the family Orchidaceae. This orchid is native to the upper Midwest and Great Lakes Basin of North America. The species was originally described as Ibidium incurvum in 1906. Long treated as part of a sensu lato Spiranthes cernua, the species complex was reevaluated and Spiranthes incurva reestablished as a separate species in 2017. Spiranthes incurva is an ancient natural hybrid of S. cernua sensu stricto and S. magnicamporum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formtuberous geophyte

Habitat & environment2

Climatetemperate

Growth formherb

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiranthes incurva has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF170209.1 ↗638 bpUSA

ACGT

GAGACCCTTGATAACCCGTGGACATGTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCGATCGGGGCATCAGA …

Spiranthes incurva voucher Pace 625 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type2 407 records

Wild obs. + sensor2 125

Museum / vouchered282

Range

Area of Occupancy AOO6 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 938≤1 km 235≤10 km 69>10 km 545

1 787 georeferenced · 338 without coordinates

Open the mapobservation + sensor2 125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 8≤1 km 34≤10 km 101>10 km 18

161 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	104
Chicago, US	83
Bronx, US	57
Philadelphia, US	21
Tampa, US	6
Madison, US	2
South Kensington, GB	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Clemson, US	1
Williamsburg, US	1
Cambridge, US	1
Green Bay, US	1
Austin, US	1

13 institutions · 281 of 282 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Spiranthes incurva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Spiranthes incurva

At a glance

Sources6 archives

Life cycle & reproduction1

Habitat & environment2

At a glance

Record type2 407 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 407 records