Spiranthes diluvialis

Sheviak · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Spiranthes

At a glance

Occurrence records409

Data sources11

Biological traits10

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Spiranthes diluvialis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility409 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF409 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 74

01Narrative

Spiranthes diluvialis is a rare species of orchid known as Ute lady's tresses (also, Ute ladies'-tresses). The species name diluvialis means "of the flood". It is native to the western United States, where there are scattered, mostly small occurrences in the states of Colorado, Idaho, Montana, Nebraska, Nevada, Utah, Washington, and Wyoming. An occurrence was recently discovered in southern British Columbia.Spiranthes diluvialis. The Nature Conservancy. Retrieved August 6, 2011. The plant faces a number of threats to its existence. It is a federally listed threatened species of the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or tuberous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiranthes diluvialis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM262299.1 ↗596 bpUSA · 2000

ACGT

GATGACCCTTGATAACCCGTGGACATGTGGCAGCGTCAGCCGCCTATAAATGCCATTCGCCCGGTGCCCCCTTCTCGATCGGGGCATCAA …

Spiranthes diluvialis isolate 06a2 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Spiranthes diluvialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 74 n = 37

Ploidypolyploid inferred

Chromosome records74–742n range74median74mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 743×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Sheviak, C. J. 1984. Spiranthes diluvialis (Orchidaceae), a new species from the western United States. Brittonia 36(1): 8–14.

CCDB · ipcn-api-dl — Sheviak, C. 1996. In B. Heidel, Spiranthes diluvialis Sheviak (Orchidaceae). Madroño 43(3): 440.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type409 records

Wild obs. + sensor380

Museum / vouchered29

Range

Area of Occupancy AOO732 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy1% within 1 km

≤100 m 3≤1 km 1>10 km 374

378 georeferenced · 2 without coordinates

Open the mapobservation + sensor380

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 6≤1 km 5≤10 km 4>10 km 4

19 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pocatello, US	8
Missoula, US	5
Bronx, US	4
WTUlocation not on record	4
Chicago, US	3
Wuzhou, CN	2
South Kensington, GB	1
Bozeman, US	1
Claremont, US	1

9 institutions · 29 of 29 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Spiranthes diluvialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)