Spiranthes casei

Catling & Cruise · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Spiranthes

At a glance

Occurrence records237

Data sources8

Biological traits10

DNA specimens9

eDNA detections5

Sources8 archives

Databases and archives Spiranthes casei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility237 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF237 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

لولوبة كاسية هي نوع من النباتات يتبع جنس اللولوبة من الفصيلة السحلبية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiranthes casei has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG215663.1 ↗381 bpCanada · 1974

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCAATTGGCTGAGGGCACGTCCGCCTGGGCGTCAAGCATT …

Spiranthes casei voucher CCDB-23112-E12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type237 records

Wild obs. + sensor110

Museum / vouchered127

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 42≤1 km 2≤10 km 4>10 km 56

104 georeferenced · 6 without coordinates

Open the mapobservation + sensor110

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 6≤1 km 8≤10 km 13>10 km 6

33 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	54
Ann Arbor, US	28
Madison, US	9
Philadelphia, US	6
Québec, CA	6
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	5
Harvard Universitylocation not on record	4
Chongqing Museumlocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Green Bay, US	2
Millersville, US	1
Denver, US	1
Museum of the Rockieslocation not on record	1
Montréal, CA	1

14 institutions · 123 of 127 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Spiranthes casei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Old sand gravel pit.Dry open sandy soil with Polytrichum mosses,…Road verges, in open and relatively dry sand…Open sandy soil along roadside.Dry, sandy open ground with Danthonia spicata

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 13.4–17.1

Seasonal swing summer↔winter28.6 °C

Max temp (day)18.6 °C 18.2–21.8

Min temp (night)11.2 °C 10.8–14.0

Precipitation114 mm/mo 101–127

Air humidity62.8 % 61.2–63.2

Moisture balance21.2 mm/mo 16.4–40.8

Vapour deficit614 Pa 569–739

Wind speed2.60 m/s 2.10–3.20

Cloud cover49.8 % 49.4–52.8

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)