Spiraea nipponica

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Spiraea

At a glance

Occurrence records190

Data sources12

Biological traits7

DNA specimens3

eDNA detections2

Sources12 archives

Databases and archives Spiraea nipponica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility190 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF190 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT880 Mbp

01Narrative

Spiraea nipponica is a species of flowering plant in the family Rosaceae, native to the island of Shikoku, Japan. Growing to 1.2 - tall and broad, it is a deciduous shrub with clusters of small, bowl-shaped white flowers in midsummer. The specific epithet nipponica means "Japanese".

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)9.14 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Spiraea nipponica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cinnamic acids and derivatives1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
trans-5-O-caffeoyl-D-quinate		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiraea nipponica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSLC133174.1 ↗637 bpJapan · 2010

ACGT

AACGACCCGAGAACCGATTTCACAAACGTCCCTTGAATCCCGCGGGGTCGCGGCCGCTCGCGTTCGCTGGTCCCCTTGAGGGACTAGCTG …

Spiraea nipponica gene for ITS1, 5.8S rRNA, ITS2, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL4★ITS4

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Spiraea nipponica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size880 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Spiraea nipponica0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×GoaT · Kew Plant DNA C-values Database · CCDB · book-atlas-flowering-plants · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-atlas-flowering-plants

CCDB · kew — Dickson EE, Arumuganathan K, Kresovich S, Doyle JJ. 1992. Nuclear DNA content variation within the Rosaceae. American Journal of Botany 79: 1081-1086.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type190 records

Wild obs. + sensor56

Museum / vouchered128

Cultivated / captive6

Origin

Introduced1

Range

Area of Occupancy AOO388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 16≤1 km 26≤10 km 1>10 km 4

47 georeferenced · 9 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 21≤1 km 9≤10 km 2>10 km 1

33 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence128

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 3 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KMNlocation not on record	14
Odawara, JP	11
SLU Artdatabankenlocation not on record	9
Riverside, US	5
Lincoln, US	5
Adam Mickiewicz University in Poznańlocation not on record	4
McWane Science Centerlocation not on record	2
MeiseBGlocation not on record	2
Edinburgh, GB	1
Beijing, CN	1
Wuzhou, CN	1
BRNUlocation not on record	1
Emporia, US	1
Moscow State Universitylocation not on record	1
Washington, US	1
Olocation not on record	1
Taipei, TW	1
Tianjin Natural History Museumlocation not on record	1
San Sebastián, ES	1
Auckland, NZ	1
Sagamihara, JP	1
Québec, CA	1
South Kensington, GB	1
Angwin, US	1
LDlocation not on record	1
Toronto, CA	1
PRClocation not on record	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Tuscaloosa, US	1
Trondheim, NO	1
Stockholm, SE	1
MAlocation not on record	1

32 institutions · 76 of 128 vouchered records shown · 51 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Spiraea nipponica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.5 °C 19.5–19.5

Seasonal swing summer↔winter22.8 °C

Max temp (day)22.8 °C

Min temp (night)13.8 °C

Precipitation156 mm/mo

Air humidity59.1 %

Moisture balance21.1 mm/mo

Vapour deficit924 Pa

Wind speed2.10 m/s

Cloud cover41.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)