Spiraea japonica
L.fil. · speciesAt a glance
Occurrence records25 107
Data sources7
Biological traits119
DNA specimens26
eDNA detections30
Sources7 archives
Databases and archives Spiraea japonica's data was compiled from.
GBIFGlobal Biodiversity Information Facility25 107 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources119 traits
Chemical compositionNPASS24 compounds
Occurrence & distributionGBIF25 107 records
Environmental DNA1 datasets · 2 countries30 detections
DNA & barcodingBOLD · NCBI26 specimens
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology14
Inflorescence length max3 cm
Inflorescence length min2 cm
Leaf length39.67 mm
Leaf length max80 mm
Leaf length min20 mm
Leaf width21.25 mm
Leaf width max30 mm
Leaf width min10 mm
Plant height1.75 m
⚠ sources differ — GIFT: 1.75 m · USDA: 0.61 m · TRY: 1.5 m
Plant height max3 m
Plant height min1 m
Seed mass0.051 mg
⚠ sources differ — TRY: 0.051 mg · GIFT: 0.055 mg
Seed mass max0.06 mg
Seed mass min0.05 mg
Life cycle & reproduction29
Bloom periodFall
Coppice potentialNo
Deciduousnessdeciduous
Flower colourred
Flower conspicuousYes
Flower length max7 mm
Flower length min4 mm
Flowering endAug
Flowering startJul
Fruit seed period beginFall
Fruit seed period endWinter
Growth rate USDAModerate
Life formshrub
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualpresent
Resprout abilityYes
Seed spread rateNone
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 400 m
Elevation mean2 400 m
Elevation min1 780 m
Epiphyteterrestrial
Foliage colorRed
Foliage porosity summerDense
Foliage porosity winterModerate
Foliage textureFine
Fruit colourbrown
Growth formshrub
Growth form USDAMultiple Stem
Habitat GIFTLowland
Hedge toleranceMedium
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min14 in
Shape and orientationSemi-Erect
Small grainNo
Woodinesswoody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min145 days
Leaf C:N ratio19.27 g/g
Leaf c498 mg/g
Leaf dry-matter content (LDMC)314 mg/g
Leaf n26.82 mg/g
Leaf p1.39 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min35 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceMedium
Soil pH max6.8 pH
Soil pH min5 pH
Specific leaf area (SLA)12.33 mm²/mg
Temperature min-23 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeseed
Fall conspicuousYes
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr0.61 m
Planting density max2 700 per acre
Planting density min1 700 per acre
03Chemical composition24 compounds
Compounds documented for Spiraea japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Rotenoids2
Isoflavanones $ Rotenoids2
Flavones2
Simple indole alkaloids1
Flavonols1
Documented compounds24 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2R,5S,7S,8S,12R,18S,21R)-12-methyl-4-methylidene-14,19-dioxa-17-azaheptacyclo[10.7.2.22,5.02,7.08,18.08,21.013,17]tricosan-3-one | present | NPASS | |
| 3,5-dihydroxy-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyphenyl]chromen-4-one | present | NPASS | |
| [(3'R,9S)-2',2'-dimethyl-4,5'-dioxo-2-phenylspiro[8H-furo[2,3-h]chromene-9,4'-oxolane]-3'-yl] acetate | present | NPASS | |
| AQBZCCQCDWNNJQ-WMZHIEFXSA-N | present | NPASS | |
| Dehydrodeguelin | present | NPASS | |
| DWUXLTHMRXTVCJ-RDWLVGASSA-N | present | NPASS | |
| HSZMQRORNAEJTB-LPAJSYIRSA-N | present | NPASS | |
| Indigo | present | NPASS | |
| Indoxyl-beta-D-glucoside | present | NPASS | |
| Legumelin | present | NPASS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spiraea japonica has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections30
Countries2
The DNA barcodea real sequence read deposited for this species
TACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACAAATTCAGACTGTGAAACTG …
Spiraea japonica small subunit ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and large subunit ribosomal RNA gene, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL6★rbcLa★ITS1★ITS2
animal barcodeplant barcodefungal barcode
08Occurrence & distribution
Record type25 107 records
Wild obs. + sensor22 238
Museum / vouchered2 770
Cultivated / captive38
Other61
Origin
Native2
Introduced285
Range
Area of Occupancy AOO66 892 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 14 732≤1 km 1 243≤10 km 1 788>10 km 273
18 036 georeferenced · 4 202 without coordinates
Open the mapobservation + sensor22 238
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 335≤1 km 151≤10 km 264>10 km 49
799 georeferenced · 1 971 without coordinates
Open the institutions mapphysical evidence2 770
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 8≤1 km 11
19 georeferenced · 19 without coordinates
Open the mapnot free-living38
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions135 of 241 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Yangling, CN | 316 |
| Shinshu Universitylocation not on record | 147 |
| SLU Artdatabankenlocation not on record | 121 |
| Odawara, JP | 99 |
| Nagano City, JP | 88 |
| Chiba, JP | 85 |
| Olocation not on record | 80 |
| Toyama, JP | 63 |
| Nagatoro-machi, Chichibu-gun, JP | 54 |
| KMNlocation not on record | 50 |
| LDlocation not on record | 46 |
| Chengdu, CN | 46 |
| Hangzhou, CN | 44 |
| Chongqing Museumlocation not on record | 38 |
| Oskarshamn, SE | 37 |
| Bando, JP | 37 |
| Tsukuba, JP | 31 |
| Helsinki, FI | 28 |
| Bergen, NO | 28 |
| DBF-NHMDlocation not on record | 26 |
| CASlocation not on record | 25 |
| Wuhan, CN | 22 |
| University of Stellenboschlocation not on record | 22 |
| Chengdu, CN | 21 |
| Beijing Normal Universitylocation not on record | 21 |
| Philadelphia, US | 20 |
| Provincia di Livornolocation not on record | 20 |
| FFPRIlocation not on record | 19 |
| Guilin, CN | 19 |
| MeiseBGlocation not on record | 19 |
| Beijing, CN | 19 |
| Yunnan Universitylocation not on record | 17 |
| JP | 17 |
| WNNUlocation not on record | 17 |
| Central China Normal Universitylocation not on record | 17 |
| Taipei, TW | 17 |
| Saint Louis, US | 17 |
| Sendai, JP | 16 |
| Nanchong, CN | 16 |
| Moscow State Universitylocation not on record | 16 |
| Oulu, FI | 15 |
| Guangzhou, CN | 14 |
| Salzburg, AT | 14 |
| Kochi, JP | 13 |
| Jiangxi Agricultural Universitylocation not on record | 13 |
| Xian, CN | 12 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 12 |
| Wuzhou, CN | 11 |
| Sanda, JP | 11 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 11 |
| BIO-UNIPIlocation not on record | 10 |
| New Haven, US | 10 |
| Christchurch, NZ | 10 |
| Nanjing, CN | 9 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 9 |
| Kunming, CN | 9 |
| Bangkok, TH | 9 |
| Fukushima Universitylocation not on record | 9 |
| KOMlocation not on record | 9 |
| Nishihara, JP | 8 |
| Trondheim, NO | 8 |
| Stockholm, SE | 8 |
| Zhejiang Universitylocation not on record | 8 |
| Cambridge, US | 8 |
| College Park, US | 8 |
| Bronx, US | 7 |
| Bloomington, US | 7 |
| Johnson City, US | 7 |
| Mlocation not on record | 6 |
| BFLlocation not on record | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Rotorua, NZ | 6 |
| Cambridge, US | 6 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 6 |
| South Kensington, GB | 6 |
| Zhuzhou, CN | 6 |
| Nanjing, CN | 6 |
| Columbia, US | 6 |
| Philadelphia, US | 5 |
| Santiago de Compostela, ES | 5 |
| Chapel Hill, US | 5 |
| West Virginia Wesleyan Collegelocation not on record | 5 |
| Bern, CH | 5 |
| Denver, US | 5 |
| Sagamihara, JP | 5 |
| Edinburgh, GB | 5 |
| Guangzhou, CN | 5 |
| Guiyang, CN | 5 |
| Adam Mickiewicz University in Poznańlocation not on record | 5 |
| Washington, US | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| WTUlocation not on record | 4 |
| Berlin, DE | 4 |
| HUFDlocation not on record | 4 |
| Taipei, TW | 4 |
| Chongqing, CN | 4 |
| Ann Arbor, US | 4 |
| Uniwersytet Warszawskilocation not on record | 4 |
| Millersville, US | 4 |
| TROMlocation not on record | 4 |
| PRClocation not on record | 4 |
| Nishihara, JP | 4 |
| Auckland, NZ | 4 |
| Awka, NG | 4 |
| Saint John, CA | 3 |
| Zürich, CH | 3 |
| Kingston, US | 3 |
| Clemson, US | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| BRNUlocation not on record | 3 |
| Chinese Academy of Forestrylocation not on record | 3 |
| Knoxville, US | 3 |
| University of New Hampshirelocation not on record | 3 |
| EMTCMlocation not on record | 3 |
| Tomioka, JP | 3 |
| Davenport, US | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Wuhan, CN | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Little Rock, US | 3 |
| GJOlocation not on record | 2 |
| Beijing, CN | 2 |
| Montréal, CA | 2 |
| Wlocation not on record | 2 |
| Fairfax, US | 2 |
| nlocation not on record | 2 |
| Xian, CN | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| St. Paul, US | 2 |
| Burlington, US | 2 |
| Williamsburg, US | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Tartu, EE | 2 |
| Tallinn, EE | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Armidale, AU | 2 |
| LfUlocation not on record | 2 |
| GZUlocation not on record | 2 |
| Pullman, US | 2 |
| Tilburg, NL | 2 |
| Lincoln, US | 2 |
| McGill University, Herbariumlocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Richmond, US | 2 |
| Uppsala, SE | 2 |
| Edmonton, CA | 2 |
| GAlocation not on record | 2 |
| Chicago, US | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| Shanghai, CN | 2 |
| Jishou Universitylocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| FJFClocation not on record | 2 |
| US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Santa Barbara, US | 2 |
| Museo universitario di Chietilocation not on record | 2 |
| Seoul, KR | 2 |
| Hangzhou Normal Collegelocation not on record | 2 |
| Wellington, NZ | 2 |
| Davis, US | 1 |
| Austin, US | 1 |
| Jyväskylä, FI | 1 |
| Pittsburg, US | 1 |
| CICYTEXlocation not on record | 1 |
| Guiyang, CN | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Minia, EG | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| Moscow, US | 1 |
| Vancouver, CA | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Emporia, US | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Cochabamba, BO | 1 |
| New Brunswick, US | 1 |
| La Paz, BO | 1 |
| PHlocation not on record | 1 |
| Springfield, US | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Tampa, US | 1 |
| Görlitz, DE | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Hudson, US | 1 |
| Parkville, AU | 1 |
| Xining, CN | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Durban, ZA | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Riverside, US | 1 |
| València, ES | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Philadelphia, US | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Pretoria, ZA | 1 |
| GMBAlocation not on record | 1 |
| Norfolk, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Toronto, CA | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Allentown, US | 1 |
| Macomb, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Staten Island, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| Nijmegen, NL | 1 |
| Hiratsuka City Museumlocation not on record | 1 |
| San Sebastián, ES | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Lanzhou, CN | 1 |
| Anhui Normal Universitylocation not on record | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Canberra, AU | 1 |
| Shanxi Universitylocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Universidad Católica de Santa Maríalocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Otaru, JP | 1 |
| Podgorica, ME | 1 |
| McWane Science Centerlocation not on record | 1 |
| Logan, US | 1 |
| Guiyang, CN | 1 |
241 institutions · 2 509 of 2 770 vouchered records shown · 234 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA30 detections
Where the DNA of Spiraea japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.1 °C 18.4–22.3
Seasonal swing summer↔winter25.4 °C
Max temp (day)25.5 °C 22.0–25.8
Min temp (night)16.6 °C 14.4–17.4
Precipitation130 mm/mo 106–256
Air humidity61.2 % 59.1–66.1
Moisture balance-10.7 mm/mo -40.6–136
Vapour deficit924 Pa 768–1,045
Wind speed2.80 m/s 1.90–3.40
Cloud cover43.8 % 38.3–48.4
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.