Spinellus fusiger

(Link) Tiegh. · species

image placeholder — illustration coming later

Fungi/Mucoromycota/Mucoromycetes/Mucorales/Phycomycetaceae/Spinellus

At a glance

Occurrence records3 375

Data sources10

Biological traits0

DNA specimens6

eDNA detections8

Sources10 archives

Databases and archives Spinellus fusiger's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 375 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 375 records

Environmental DNA2 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceGoaT · NCBI≈38 Mbp

01Narrative

Spinellus fusiger, commonly known as the bonnet mold, is a species of fungus in the Zygomycota phylum. It is a pin mold that is characterized by erect sporangiophores (specialized hyphae that bear a sporangium) that are simple in structure, brown or yellowish-brown in color, and with branched aerial filaments that bear the zygospores. It grows as a parasitic mold on mushrooms, including several species from the genera Mycena, including M. haematopus, M. pura, M. epipterygia, M. leptocephala, and various Collybia species, such as C. alkalivirens, C. luteifolia, C. dryophila, and C. butyracea. It has also been found growing on agaric species in Amanita, Gymnopus, and Hygrophorus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spinellus fusiger has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

GenBank sequences7

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJN206296.1 ↗702 bp

ACGT

TTTTTTTGTTTTATTTTGTAAGTATGCTCTCCTGAGTCTGGCAATTGCGTCTTTCTCCCTGACATCATAAATAATCTCAAGGAATTTGTA …

Spinellus fusiger strain CBS 894.73 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Spinellus fusiger carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈38 198 483 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Spinellus fusiger0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type3 375 records

Wild obs. + sensor3 264

Museum / vouchered109

Other2

Range

Area of Occupancy AOO10 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 1 053≤1 km 525≤10 km 1 196>10 km 77

2 851 georeferenced · 413 without coordinates

Open the mapobservation + sensor3 264

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 10≤1 km 26≤10 km 12>10 km 10

58 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	11
Philadelphia, US	10
Pullman, US	8
Oulu, FI	7
Karlsruhe, DE	5
WU-MYClocation not on record	5
Helsinki, FI	4
Odawara, JP	4
Olocation not on record	4
FLASlocation not on record	4
Catholic University of Pekinglocation not on record	3
Toronto, CA	3
Bronx, US	2
Kew, GB	2
St. Paul, US	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Chicago, US	2
Copenhagen, DK	2
TROMlocation not on record	2
San Sebastián, ES	1
Stockholm, SE	1
Görlitz, DE	1
BDBClocation not on record	1
Tartu, EE	1
Vancouver, CA	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Yerevan, AM	1
LDlocation not on record	1
nsnflocation not on record	1
SLU Artdatabankenlocation not on record	1
PHlocation not on record	1
University of the Basque Country (UPV/EHU)location not on record	1
Gijón, ES	1
California State University, East Baylocation not on record	1

34 institutions · 97 of 109 vouchered records shown · 12 without an institution code

09Environmental DNA8 detections

Where the DNA of Spinellus fusiger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 12.1–16.4

Seasonal swing summer↔winter21.8 °C

Max temp (day)18.2 °C 16.5–21.4

Min temp (night)6.50 °C 6.10–13.7

Precipitation54.0 mm/mo 25.8–61.4

Air humidity56.9 % 45.5–60.4

Moisture balance-43.3 mm/mo

Vapour deficit751 Pa 625–888

Wind speed3.80 m/s

Cloud cover37.7 % 19.6–38.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Spinellus fusiger

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 375 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 375 records