Spialia nanus

(Trimen, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hesperiidae/Spialia

At a glance

Occurrence records238

Data sources9

Biological traits0

DNA specimens7

eDNA detections7

Sources9 archives

Databases and archives Spialia nanus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility238 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF238 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

Genome at a glanceNCBI≈60 Mbp

01Narrative

Spialia nanus, the dwarf sandman, is a butterfly of the family Hesperiidae. It is found in South Africa, in the western Cape, western Free State, southern North West Province and the northern Cape. The wingspan is 18–24 mm for males and 23–27 mm for females. There are two generations per year with peaks from March to April and from September to October. The larvae feed on Hermannia species (including Hermannia diffusa, Hermannia incana, Hermannia comosa, Hermannia cuneifolia, Hermannia pulverata) and Hebiscus aethiopicus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spialia nanus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P554 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.18%

Where individuals differ — all 2 variable positions, in barcode order

375Gmostly conserved

450Amostly conserved

CTTATTCGATCAGAATTAGGTACTCCCGGATCCTTAATTGGAGATGATCAAATCTACAATACTATTGTAACAGCTCATGCTTTTATTATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Carcharodus baeticussame family9.4%Carcharodus flocciferasame family9.6%Staphylus tucumanussame family9.7%Ambulyx sericeipennissame order9.7%Carcharodus lavatheraesame family9.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Spialia nanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈60 472 275 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Spialia nanus0.06 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

08Occurrence & distribution

Record type238 records

Wild obs. + sensor81

Museum / vouchered157

Range

Area of Occupancy AOO468 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 4≤1 km 12≤10 km 20

36 georeferenced · 45 without coordinates

Open the mapobservation + sensor81

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence157

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Teylers Museumlocation not on record	88
Durban Natural Science Museumlocation not on record	20
Iziko South African Museumlocation not on record	18
Cape Town, ZA	11
Northern Michigan Universitylocation not on record	5
Cambridge, US	4
Sydney, AU	4
National Museums of Kenyalocation not on record	4
KwaZulu-Natal Museumlocation not on record	3

9 institutions · 157 of 157 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Spialia nanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 17.7–19.8

Seasonal swing summer↔winter15.1 °C

Max temp (day)26.2 °C 24.6–26.8

Min temp (night)11.1 °C 9.50–13.2

Precipitation34.3 mm/mo 14.8–45.5

Air humidity49.1 % 46.6–52.4

Moisture balance-107 mm/mo -151–-95.9

Vapour deficit1,151 Pa 994–1,187

Wind speed4.20 m/s 3.30–4.70

Cloud cover19.2 % 14.7–22.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)