Sphyraena japonica

Bloch & Schneider, 1801 · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Sphyraenidae/Sphyraena

At a glance

Occurrence records479

Data sources10

Biological traits0

DNA specimens34

eDNA detections29

Sources10 archives

Databases and archives Sphyraena japonica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility293 records↗

OBISOcean Biodiversity Information System186 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS77 compounds

Occurrence & distributionGBIF · OBIS479 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD34 specimens

01Narrative

The Japanese barracuda (Sphyraena japonica) is a species of fish of the family Sphyraenidae, which can be found in West Pacific ocean near southern Japan as well as in the South China Sea.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition77 compounds

Compounds documented for Sphyraena japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols4

Dihydroflavonols1

Jasmonic acids1

Chalcones1

Documented compounds77 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-taxifolin	present	NPASS
3-[(2R,3S,4R,5R,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-2-(4-hydroxyphenyl)-7-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
[(2S,3R,4S,5S,6R)-2-[(2S,3R,4S,5S,6R)-2-[5,7-dihydroxy-2-(4-hydroxyphenyl)-4-oxochromen-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
ABHQAJURQQRCCE-ROUNSZIUSA-O	present	NPASS
AJRGNJQJDOBFRE-YOURJPLGSA-N	present	NPASS
AWDPOTSGERXGCA-QGBQGETJSA-N	present	NPASS
AZADMQNLGDQCPV-PODAWQKSSA-N	present	NPASS
BYEFUYPJCOTACA-TXWHVLLVSA-N	present	NPASS
Chalconaringenin	present	NPASS
DGGWHUCHBQNSNH-OQRRKOMRSA-O	present	NPASS

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphyraena japonica has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes11

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P578 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

198Tmostly conserved

CTAAGCCAACCAGGCTCTCTTCTAGGAGACGATCAGATTTATAATGTAATCGTAACAGCACATGCATTCGTAATAATCTTTTTTATGGTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.08%

Haplotypes4

BIN1

Most divergent pair0.52%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphyraena waitiisame genus6.7%Sphyraena acutipinnissame genus7.1%Sphyraena novaehollandiaesame genus16.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_022489 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type479 records

Wild obs. + sensor48

Museum / vouchered404

Other27

Range

Area of Occupancy AOO512 km²

Depth

0–200 m sunlit13

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 100 m · max 200 m · 13 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 3≤10 km 2

5 georeferenced · 43 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤10 km 2>10 km 6

9 georeferenced · 395 without coordinates

Open the institutions mapphysical evidence404

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kagoshima University Museumlocation not on record	228
Fisheries Research Laboratory, Mie Universitylocation not on record	5
Ann Arbor, US	4
CASlocation not on record	2
Stockholm, SE	1
Paris, FR	1
Gifu prefectural Museumlocation not on record	1
University of California San Diegolocation not on record	1

8 institutions · 243 of 404 vouchered records shown · 10 without an institution code

09Environmental DNA29 detections

Where the DNA of Sphyraena japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 10.0–28.8

Seasonal swing summer↔winter11.7 °C

Max temp (day)24.6 °C 15.7–29.4

Min temp (night)22.3 °C 3.10–26.9

Precipitation168 mm/mo 13.8–273

Air humidity64.5 % 45.7–68.3

Vapour deficit1,047 Pa 827–1,246

Cloud cover47.0 % 24.1–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)