Sphrageidus similis

Füssly, 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Sphrageidus

At a glance

Occurrence records17 084

Data sources8

Biological traits0

DNA specimens101

eDNA detections4

Sources8 archives

Databases and archives Sphrageidus similis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 084 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics101 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF17 084 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD101 specimens

Genome at a glanceGoaT · NCBI≈508 Mbp

01Narrative

モンシロドクガは、チョウ目ドクガ科に属するガの一種である。

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding101 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphrageidus similis has left across the world's sequence archives.

At a glance

DNA specimens101

BINs2

Marker genes1

eDNA detections4

Countries17

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus98 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 50 variable positions, in barcode order

1Amostly conserved

2Cmostly conserved

4Cmostly conserved

5Tmostly conserved

8Amostly conserved

9Cmostly conserved

10Tmostly conserved

11Tmostly conserved

13Amostly conserved

19Gmostly conserved

20Gmostly conserved

21Amostly conserved

22Amostly conserved

23Tmostly conserved

26Gmostly conserved

27Amostly conserved

28Gmostly conserved

29Cmostly conserved

30Amostly conserved

31Gmostly conserved

33Amostly conserved

78Amostly conserved

81Tmostly conserved

87Amostly conserved

96Tmostly conserved

129Amostly conserved

132Tmostly conserved

159Amostly conserved

165Avariable

177Tmostly conserved

180Gmostly conserved

183Avariable

186Tvariable

222Cmostly conserved

225Tmostly conserved

267Avariable

321Tmostly conserved

336Cmostly conserved

352Gmostly conserved

354Amostly conserved

360Cmostly conserved

399Cvariable

432Gvariable

478Cmostly conserved

495Avariable

505Gmostly conserved

531Cmostly conserved

579Amostly conserved

627Gmostly conserved

645Tvariable

ACACTTTACTTTATTTTTGGAATTTGAGCAGGAATAATTGGCTCATCCTTAAGATTAATAATTCGTGCAGAATTAGGAACTCCTGGATCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes24

BINs2

Most divergent pair5.8%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphrageidus rubricostasame genus8.8%Euproctis pulvereasame family12.0%Euproctis galactopissame family12.0%Perithalera oblongatasame order12.6%Nemoria saturibasame order12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sphrageidus similis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈507 633 075 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sphrageidus similis0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Chromosome records22–462n range44median44mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 231×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

2n 441×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 461×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.6% BUSCO

08Occurrence & distribution

Record type17 084 records

Wild obs. + sensor13 308

Museum / vouchered3 750

Other26

Origin

Native5

Range

Area of Occupancy AOO27 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 5 295≤1 km 2 548≤10 km 2 542>10 km 317

10 702 georeferenced · 2 606 without coordinates

Open the mapobservation + sensor13 308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 2 103≤1 km 310≤10 km 716>10 km 27

3 156 georeferenced · 594 without coordinates

Open the institutions mapphysical evidence3 750

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	2 312
South Kensington, GB	437
Helsinki, FI	376
Salzburg, AT	112
Tallinn, EE	26
JP	26
Iwate Prefectural Museumlocation not on record	21
NMOKlocation not on record	20
Metsähallituslocation not on record	18
Auckland, NZ	13
RCMlocation not on record	13
Hiwa Museum of Natural Historylocation not on record	12
Provincia di Livornolocation not on record	11
ZMAAlocation not on record	10
KIRMlocation not on record	9
Shiojiri City Museum of Natural Historylocation not on record	8
John May Museum of Natural Historylocation not on record	8
NHMOlocation not on record	7
Sam Noble Oklahoma Museum of Natural Historylocation not on record	7
Kuopio, FI	7
Toyota city nature sanctuarylocation not on record	2
Rovaniemi, FI	2
Kawasaki Shi Tama Ku, JP	1
Bavarian State Collection of Zoologylocation not on record	1
Toyama, JP	1
Wellcome Sanger Institutelocation not on record	1

26 institutions · 3 461 of 3 750 vouchered records shown · 288 without an institution code

09Environmental DNA4 detections

Where the DNA of Sphrageidus similis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 7.70–25.3

Seasonal swing summer↔winter11.4 °C

Max temp (day)20.2 °C 10.2–31.0

Min temp (night)10.5 °C 4.30–18.9

Precipitation84.9 mm/mo 43.0–194

Air humidity61.1 % 53.5–65.0

Moisture balance51.4 mm/mo -117–86.0

Vapour deficit708 Pa 392–1,573

Wind speed2.50 m/s 1.80–4.60

Cloud cover35.7 % 15.7–48.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphrageidus similis

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type17 084 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 084 records