Sphodros niger

(Hentz, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Atypidae/Sphodros

At a glance

Occurrence records774

Data sources8

Biological traits1

DNA specimens13

eDNA detections3

Sources8 archives

Databases and archives Sphodros niger's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility774 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF774 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD13 specimens

01Narrative

Sphodros niger, the black purse-web spider, is a mygalomorph spider from the Eastern United States.Fitch, Henry S. (1963): Spiders of The University of Kansas Natural History Reservation and Rockefeller Experimental Tract. It is listed as a special concern species in Connecticut."Connecticut's Endangered, Threatened and Special Concern Species 2015". State of Connecticut Department of Energy and Environmental Protection Bureau of Natural Resources. Retrieved 10 January 2018.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGBIF 2020

Ecology1

Range size2 142 mm

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphodros niger has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

120Amostly conserved

121Cmostly conserved

138Gmostly conserved

189Gmostly conserved

219Tmostly conserved

444Tmostly conserved

477Tmostly conserved

573Cvariable

612Tmostly conserved

613Gmostly conserved

614Amostly conserved

615Tmostly conserved

617Cmostly conserved

619Tmostly conserved

620Cmostly conserved

621Tmostly conserved

623Gmostly conserved

624Amostly conserved

626Gmostly conserved

627Tmostly conserved

631Gmostly conserved

632Amostly conserved

633Tmostly conserved

635Cmostly conserved

636Tmostly conserved

637Amostly conserved

ACGTTATATTTGATTTTAGGTGTGTGATCGGGAATGATAGGGATATCTATGAGAATGATTATTCGAATAGAGTTGTCACATTTAGGTAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes3

BINs2

Most divergent pair3.8%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type774 records

Wild obs. + sensor719

Museum / vouchered55

Range

Area of Occupancy AOO2 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 389≤1 km 95≤10 km 46>10 km 87

617 georeferenced · 102 without coordinates

Open the mapobservation + sensor719

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 1≤1 km 4≤10 km 1

6 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	16
Cambridge, US	13
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Chicago, US	6
Denver, US	2
University Park, US	1

6 institutions · 46 of 55 vouchered records shown · 9 without an institution code

09Environmental DNA3 detections

Where the DNA of Sphodros niger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

GrasslandMixed deciduous hardwoods

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 15.9–21.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.9 °C 20.7–26.2

Min temp (night)14.2 °C 11.7–16.8

Precipitation94.5 mm/mo 86.7–114

Air humidity57.7 % 56.7–58.2

Moisture balance-39.2 mm/mo -54.0–-37.6

Vapour deficit855 Pa 783–1,075

Wind speed2.90 m/s 2.50–3.50

Cloud cover41.1 % 35.7–42.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)