Sphiximorpha willistoni

(Kahl, 1897) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Sphiximorpha

At a glance

Occurrence records329

Data sources6

Biological traits0

DNA specimens23

eDNA detections13

Sources6 archives

Databases and archives Sphiximorpha willistoni's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility329 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF329 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD23 specimens

01Narrative

Sphiximorpha willistoni (Kahl, 1897), or Williston's wasp fly, is a rare species of syrphid fly found in eastern North America. It is a strong wasp mimic. Hoverflies can remain nearly motionless in flight. The adults are also known as flower flies for they are commonly found on flowers from which they get both enegy-giving nectar and protein rich pollen. Larvae in this genus are found in sap runs of trees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphiximorpha willistoni has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes11

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

79Amostly conserved

244Gvariable

247Tvariable

316Gmostly conserved

373Amostly conserved

496Gmostly conserved

499Tvariable

542Tmostly conserved

628Gmostly conserved

640Tmostly conserved

646Tvariable

649Amostly conserved

653Tmostly conserved

658Tmostly conserved

TACATTATATTTTATTTTCGGTACATGAGCTGGAATAGTAGGAACTTCTTTAAGTATTCTTATTCGTGCAGAATTAGGACACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes6

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Monoceromyia superbasame family7.6%Sphiximorpha subsessilissame genus7.6%Brachypalpus oarussame family7.9%Polybiomyia bergrothisame family8.1%Hadromyia crawfordisame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28SAATSCAD-3PCAD-5PCK1PERRBM15TULP

animal barcoderibosomalmarker

08Occurrence & distribution

Record type329 records

Wild obs. + sensor213

Museum / vouchered116

Range

Area of Occupancy AOO904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 107≤1 km 31≤10 km 11>10 km 30

179 georeferenced · 34 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 116 records without

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	112
CUlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
University Park, US	1

4 institutions · 116 of 116 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Sphiximorpha willistoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Foresthilltop

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 13.8–18.9

Seasonal swing summer↔winter31.2 °C

Max temp (day)21.5 °C 19.0–23.8

Min temp (night)13.6 °C 8.20–13.9

Precipitation97.4 mm/mo 94.1–109

Air humidity57.9 % 55.6–58.8

Moisture balance-40.0 mm/mo -59.5–-28.7

Vapour deficit811 Pa 703–918

Wind speed3.90 m/s 3.10–4.20

Cloud cover44.8 % 43.1–48.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)