Sphingonaepiopsis nana

Walker, 1856 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphingonaepiopsis

At a glance

Occurrence records102

Data sources7

Biological traits0

DNA specimens22

eDNA detections23

Sources7 archives

Databases and archives Sphingonaepiopsis nana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF102 records

Environmental DNA1 datasets · 8 countries23 detections

DNA & barcodingBOLD22 specimens

01Narrative

Sphingonaepiopsis nana, the savanna hawkmoth, is a moth of the family Sphingidae. The species was first described by Francis Walker in 1856. It is found from the Kerman Province, Hormozgan Province and Baluchistan in southern Iran and western Saudi Arabia to the southern Arabian Peninsula (including the United Arab Emirates, northern Oman and Yemen) and eastern Africa to Natal, west to the Gambia. The wingspan is 25–30 mm. Adults are on wing in March and April. A specimen captured in early October indicates there might be a second generation. The larvae feed on various Rubiaceae species, including Kohautia, Galium, Rubia and Jaubertia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphingonaepiopsis nana has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections23

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

4Amostly conserved

40Avariable

142Tvariable

145Tvariable

202Gvariable

235Cvariable

364Cvariable

400Cvariable

412Avariable

430Avariable

477Amostly conserved

508Cvariable

565Avariable

574Cvariable

589Tvariable

604Cvariable

610Cmostly conserved

619Tvariable

634Cvariable

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BINs2

Most divergent pair2.9%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pachylia darcetasame family7.9%Nola analissame order8.0%Sphecodina abbottiisame family8.2%Macrochilo absorptalissame order8.2%Bryophila amoenissimasame order8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type102 records

Wild obs. + sensor58

Museum / vouchered44

Range

Area of Occupancy AOO300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 20≤1 km 7≤10 km 4>10 km 1

32 georeferenced · 26 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	23
Durban Natural Science Museumlocation not on record	10
South Kensington, GB	6
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of Jean Haxairelocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

6 institutions · 42 of 44 vouchered records shown · 2 without an institution code

09Environmental DNA23 detections

Where the DNA of Sphingonaepiopsis nana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map8 countries0

Thorn Veld2. Savanna | 2.1. Dry Savanna

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 17.7–27.7

Seasonal swing summer↔winter5.00 °C

Max temp (day)29.5 °C 24.3–34.1

Min temp (night)20.9 °C 11.8–24.0

Precipitation63.0 mm/mo 19.2–243

Air humidity57.9 % 50.5–66.0

Moisture balance-66.4 mm/mo

Vapour deficit1,193 Pa 952–1,788

Wind speed2.60 m/s

Cloud cover24.5 % 13.5–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)