Sphingonaepiopsis ansorgei

Rothschild, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphingonaepiopsis

At a glance

Occurrence records34

Data sources7

Biological traits0

DNA specimens5

eDNA detections6

Sources7 archives

Databases and archives Sphingonaepiopsis ansorgei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility34 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF34 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD5 specimens

01Narrative

Sphingonaepiopsis ansorgei is a moth of the family Sphingidae. It is known from open habitats from northern South Africa to East Africa in the east and to Angola in the west. The length of the forewings is 14–15 mm. The ground colour of the body and forewings is reddish. Dark spots are absent, but replaced by a broad, rather diffuse diagonal band. The hindwings are uniform reddish.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphingonaepiopsis ansorgei has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

202Amostly conserved

205Avariable

217Amostly conserved

367Tvariable

412Amostly conserved

415Amostly conserved

499Tvariable

505Tmostly conserved

628Amostly conserved

646Tvariable

AACATTATATTTTATTTTCGGAATTTGAGCAGGTTTAGTTGGAACCTCATTAAGTTTATTAATTCGAGCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.73%

Haplotypes4

BIN1

Most divergent pair1.5%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphingonaepiopsis gorgoniadessame genus8.1%Rethera komarovisame family8.2%Limbatochlamys pararosthornisame order8.4%Polyptychus dargeisame family8.4%Unzela japixsame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type34 records

Wild obs. + sensor10

Museum / vouchered24

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 1

7 georeferenced · 3 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	9
New Haven, US	6
Durban Natural Science Museumlocation not on record	3
South Kensington, GB	3

4 institutions · 21 of 24 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Sphingonaepiopsis ansorgei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–18.6

Seasonal swing summer↔winter5.30 °C

Max temp (day)20.7 °C 20.7–23.1

Min temp (night)12.2 °C 12.2–14.7

Precipitation219 mm/mo 219–252

Air humidity63.6 % 63.6–65.5

Moisture balance88.9 mm/mo 88.9–119

Vapour deficit677 Pa 677–743

Wind speed1.70 m/s

Cloud cover37.4 % 37.4–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)