Sphictostethus nitidus

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Pompilidae/Sphictostethus

At a glance

Occurrence records893

Data sources6

Biological traits0

DNA specimens8

eDNA detections7

Sources6 archives

Databases and archives Sphictostethus nitidus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility893 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF893 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD8 specimens

01Narrative

Sphictostethus nitidus, the golden hunter wasp or red spider wasp, is a species of pepsid spider wasp endemic to New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphictostethus nitidus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs3

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Diversity (π)8.6%

Haplotypes1

BINs3

Where individuals differ — all 128 variable positions, in barcode order

67Cvariable

82Avariable

121Avariable

163Gmostly conserved

166Amostly conserved

179Cvariable

187Tvariable

188Cmostly conserved

250Amostly conserved

280Gvariable

310Gmostly conserved

316Amostly conserved

319Tmostly conserved

325Tmostly conserved

352Tvariable

397Avariable

445Amostly conserved

446Tmostly conserved

447Amostly conserved

448Tmostly conserved

453Gmostly conserved

456Amostly conserved

458Tmostly conserved

459Cmostly conserved

464Gmostly conserved

465Amostly conserved

467Amostly conserved

469Amostly conserved

470Tmostly conserved

471Tmostly conserved

472Amostly conserved

474Cmostly conserved

475Tmostly conserved

479Tmostly conserved

480Tmostly conserved

483Cmostly conserved

484Amostly conserved

486Gmostly conserved

487Amostly conserved

491Gmostly conserved

492Tmostly conserved

493Tmostly conserved

494Amostly conserved

495Tmostly conserved

497Amostly conserved

501Cmostly conserved

503Gmostly conserved

504Cmostly conserved

505Avariable

507Tmostly conserved

508Tmostly conserved

509Tmostly conserved

510Tmostly conserved

512Tmostly conserved

514Gvariable

522Cmostly conserved

527Cmostly conserved

530Gmostly conserved

532Tmostly conserved

533Tmostly conserved

534Tmostly conserved

537Cmostly conserved

539Gmostly conserved

540Gmostly conserved

541Gvariable

544Amostly conserved

545Amostly conserved

546Tmostly conserved

547Tmostly conserved

548Amostly conserved

553Amostly conserved

554Tmostly conserved

555Tmostly conserved

557Tmostly conserved

561Cmostly conserved

562Tmostly conserved

563Gmostly conserved

564Amostly conserved

565Cvariable

566Cmostly conserved

567Gmostly conserved

569Amostly conserved

572Tmostly conserved

573Tmostly conserved

574Gvariable

578Amostly conserved

579Cmostly conserved

580Tmostly conserved

581Tmostly conserved

582Cmostly conserved

583Amostly conserved

584Tmostly conserved

585Tmostly conserved

588Tmostly conserved

589Tmostly conserved

590Amostly conserved

591Amostly conserved

592Cmostly conserved

593Cmostly conserved

594Cmostly conserved

597Tmostly conserved

598Tmostly conserved

599Gmostly conserved

600Gmostly conserved

601Gmostly conserved

602Gmostly conserved

603Gmostly conserved

604Gmostly conserved

606Gmostly conserved

607Tvariable

609Avariable

610Tvariable

611Cvariable

612Cvariable

613Avariable

614Avariable

615Tvariable

617Tvariable

618Tvariable

620Tvariable

+8 more variable positions not shown

TGCGTTATGGTCGGGAGCTCTCGGTACTTCTTTAAGTTTAATTATTCGAATTGAATTAGGTAGTCCCGGACAAGTTTTAGGAAATGATCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Auplopus rectussame family15.1%Priocnemis cordivalvatasame family16.1%Priocnemis nothasame family16.3%Auplopus nigroaurantiacussame family16.4%Poecilagenia reversasame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type893 records

Wild obs. + sensor372

Museum / vouchered521

Origin

Native269

Range

Area of Occupancy AOO1 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 177≤1 km 95≤10 km 22>10 km 19

313 georeferenced · 59 without coordinates

Open the mapobservation + sensor372

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 14≤1 km 77≤10 km 54

145 georeferenced · 376 without coordinates

Open the institutions mapphysical evidence521

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MWLRlocation not on record	269
New Zealand Arthropod Collectionlocation not on record	155
Auckland, NZ	96

3 institutions · 520 of 521 vouchered records shown · 1 without an institution code

09Environmental DNA7 detections

Where the DNA of Sphictostethus nitidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 14.3–18.5

Seasonal swing summer↔winter9.70 °C

Max temp (day)20.4 °C 17.4–21.8

Min temp (night)12.9 °C 10.8–14.6

Precipitation118 mm/mo 87.8–146

Air humidity61.3 % 60.3–62.5

Moisture balance-32.0 mm/mo -71.4–38.8

Vapour deficit760 Pa 626–840

Wind speed4.20 m/s 4.00–4.80

Cloud cover37.1 % 34.4–37.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)