Sphex funerarius

Gussakovskij, 1934 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Sphex

At a glance

Occurrence records9 783

Data sources6

Biological traits0

DNA specimens20

eDNA detections13

Sources6 archives

Databases and archives Sphex funerarius's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 783 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF9 783 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD20 specimens

01Narrative

Sphex funerarius, the golden digger wasp, is a species of digger wasp of the family Sphecidae.BiolibITIS Report

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphex funerarius has left across the world's sequence archives.

At a glance

DNA specimens20

BINs3

Marker genes1

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

74Tmostly conserved

94Amostly conserved

106Cmostly conserved

118Cmostly conserved

145Tmostly conserved

190Tvariable

200Amostly conserved

205Avariable

217Amostly conserved

250Cvariable

274Cvariable

283Tvariable

304Cvariable

340Cvariable

343Cvariable

367Cvariable

372Amostly conserved

373Cvariable

376Cvariable

382Amostly conserved

403Cmostly conserved

458Cmostly conserved

478Amostly conserved

500Tmostly conserved

526Cvariable

536Tmostly conserved

553Avariable

559Tvariable

571Cvariable

616Tvariable

619Amostly conserved

628Gmostly conserved

631Amostly conserved

641Cvariable

646Tvariable

653Cmostly conserved

AATACTTTACTTTATCTTTAGAATATGATCCGGCATACTAGGATCTTCTTTAAGTCTTTTAATCCGTCTAGAATTAGGATCTCCTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes8

BINs3

Most divergent pair20.5%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphex maroccanussame genus10.3%Sphex flavipennissame genus14.1%Sphex schlaefleisame genus15.0%Sphex lucaesame genus16.4%Sphex schmideggerisame genus17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 783 records

Wild obs. + sensor9 455

Museum / vouchered328

Origin

Native2

Range

Area of Occupancy AOO14 472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 2 524≤1 km 1 575≤10 km 3 861>10 km 120

8 080 georeferenced · 1 375 without coordinates

Open the mapobservation + sensor9 455

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 16≤1 km 75≤10 km 103>10 km 1

195 georeferenced · 133 without coordinates

Open the institutions mapphysical evidence328

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	128
Muzeum Górnośląskie w Bytomiulocation not on record	29
Uniwersytet Łódzkilocation not on record	27
SLU Artdatabankenlocation not on record	15
Adam Mickiewicz University in Poznańlocation not on record	14
Provincia di Livornolocation not on record	13
Philadelphia, US	12
Museu Nacional de História Natural e da Ciêncialocation not on record	11
ZSMlocation not on record	7
Natural History Museum Rotterdamlocation not on record	4
UGRlocation not on record	3
IMEDEAlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Tilburg, NL	1
Bavarian State Collection of Zoologylocation not on record	1

15 institutions · 267 of 328 vouchered records shown · 61 without an institution code

09Environmental DNA13 detections

Where the DNA of Sphex funerarius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

urban area

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.1 °C 19.2–24.4

Seasonal swing summer↔winter18.7 °C

Max temp (day)23.6 °C 23.5–28.2

Min temp (night)16.1 °C 13.6–18.9

Precipitation65.1 mm/mo 38.2–82.3

Air humidity56.9 % 54.9–59.9

Moisture balance-75.5 mm/mo -118–-28.0

Vapour deficit995 Pa 930–1,380

Wind speed2.10 m/s 1.50–3.60

Cloud cover34.4 % 33.5–38.2

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphex funerarius

At a glance

Sources6 archives

At a glance

Record type9 783 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 783 records