Sphenophorus costipennis

Horn, 1873 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Dryophthoridae/Sphenophorus

At a glance

Occurrence records101

Data sources5

Biological traits0

DNA specimens9

eDNA detections8

Sources5 archives

Databases and archives Sphenophorus costipennis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility101 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF101 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD9 specimens

01Narrative

Sphenophorus costipennis is a species of beetle in the family Dryophthoridae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphenophorus costipennis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.71%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 9 variable positions, in barcode order

43Amostly conserved

262Amostly conserved

302Amostly conserved

319Avariable

358Tmostly conserved

391Cmostly conserved

532Amostly conserved

538Tmostly conserved

565Gmostly conserved

AACTTTATACTTTATTTTTGGGGCTTGAGCTGGAATAGTCGGAACTTCTCTAAGATTATTGATTCGAGCAGAATTAGGTAACCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphenophorus venatussame genus14.1%Metamasius hemipterussame family16.1%Sitona hispidulussame family16.2%Cactophagus duplocinctussame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type101 records

Wild obs. + sensor39

Museum / vouchered62

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 15≤1 km 10≤10 km 3>10 km 2

30 georeferenced · 9 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 9>10 km 8

18 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	27
ASUlocation not on record	8
Cambridge, US	6
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
University of Guelphlocation not on record	5
Albany, US	3
Lexington, US	2
CUlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Saint John, CA	1

11 institutions · 60 of 62 vouchered records shown · 2 without an institution code

09Environmental DNA8 detections

Where the DNA of Sphenophorus costipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

BeachWetRiparian ZoneGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 13.3–17.8

Seasonal swing summer↔winter28.8 °C

Max temp (day)19.6 °C 16.4–22.5

Min temp (night)13.0 °C 9.30–14.2

Precipitation67.6 mm/mo 65.2–86.8

Air humidity60.0 % 58.2–62.2

Moisture balance-53.5 mm/mo -64.2–-46.7

Vapour deficit619 Pa 617–827

Wind speed2.20 m/s 2.20–2.50

Cloud cover41.0 % 39.9–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)