Sphenomorphus maculatus

(Blyth, 1853) · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Scincidae/Sphenomorphus

At a glance

Occurrence records2 514

Data sources8

Biological traits0

DNA specimens11

eDNA detections10

Sources8 archives

Databases and archives Sphenomorphus maculatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 514 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 514 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Sphenomorphus maculatus, the spotted forest skink, maculated forest skink or stream-side skink is a species of skink found in China, South Asia and Southeast Asia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphenomorphus maculatus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs2

Marker genes2

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

33Amostly conserved

39Gmostly conserved

51Gmostly conserved

87Gmostly conserved

89Cmostly conserved

91Tmostly conserved

108Amostly conserved

120Cmostly conserved

135Tmostly conserved

141Cmostly conserved

144Tmostly conserved

159Amostly conserved

177Tmostly conserved

189Gmostly conserved

222Tmostly conserved

264Amostly conserved

273Cmostly conserved

283Tmostly conserved

285Gmostly conserved

291Tmostly conserved

318Tmostly conserved

324Amostly conserved

342Cmostly conserved

351Tmostly conserved

354Amostly conserved

360Gmostly conserved

393Cmostly conserved

402Amostly conserved

423Amostly conserved

471Cmostly conserved

486Amostly conserved

528Tmostly conserved

531Tmostly conserved

535Cmostly conserved

540Amostly conserved

543Amostly conserved

555Gmostly conserved

573Tmostly conserved

591Gmostly conserved

600Tmostly conserved

606Gmostly conserved

624Amostly conserved

630Gmostly conserved

651Cvariable

654Avariable

ACCCTTTATTTAATCTTTGGCGCCTGAGCAGGAATAGTGGGCACTGCCCTGAGCCTGCTAATTCGTGCTGAACTAAGTCAGCCTGGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes3

BINs2

Most divergent pair0.31%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphenomorphus melanopogonsame genus17.3%Takydromus sexlineatussame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type2 514 records

Wild obs. + sensor1 427

Museum / vouchered1 086

Other1

Range

Area of Occupancy AOO3 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 447≤1 km 405≤10 km 135>10 km 134

1 121 georeferenced · 306 without coordinates

Open the mapobservation + sensor1 427

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 138≤1 km 19≤10 km 21>10 km 17

195 georeferenced · 891 without coordinates

Open the institutions mapphysical evidence1 086

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	643
Washington, US	245
Wuzhou, CN	42
Cambridge, US	26
North Carolina Museum of Natural Scienceslocation not on record	21
Sam Noble Oklahoma Museum of Natural Historylocation not on record	13
Bombay Natural History Societylocation not on record	8
South Kensington, GB	7
Berkeley, US	6
Ann Arbor, US	6
Brussels, BE	4
RBINS-Scientific Heritagelocation not on record	4
Natural History Museum, Tribhuvan Universitylocation not on record	2
Stockholm, SE	1
SVLlocation not on record	1
Copenhagen, DK	1

16 institutions · 1 030 of 1 086 vouchered records shown · 56 without an institution code

09Environmental DNA10 detections

Where the DNA of Sphenomorphus maculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 25.2–25.9

Seasonal swing summer↔winter3.00 °C

Max temp (day)29.4 °C 27.8–30.0

Min temp (night)21.4 °C 20.8–22.6

Precipitation195 mm/mo 157–485

Air humidity66.0 % 65.0–74.0

Moisture balance69.5 mm/mo 41.0–354

Vapour deficit1,112 Pa 830–1,164

Wind speed1.40 m/s 1.30–2.00

Cloud cover43.6 % 38.1–69.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphenomorphus maculatus

At a glance

Sources8 archives

At a glance

Record type2 514 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 514 records