Sphenella marginata

(Fallén, 1814) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Sphenella

At a glance

Occurrence records2 991

Data sources9

Biological traits2

DNA specimens31

eDNA detections2

Sources9 archives

Databases and archives Sphenella marginata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 991 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 991 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD31 specimens

Genome at a glanceGoaT · NCBI≈595 Mbp

01Narrative

Sphenella marginata is a species of fly in the family Tephritidae, the gall flies. It is found in the Palearctic .Fauna EuropaeaBei-Bienko, G.Y. & Steyskal, G.C. (1988) Keys to the Insects of the European Part of the USSR, Volume V: Diptera and Siphonaptera, Parts I. II. Amerind Publishing Co., New Delhi.Séguy, E. (1934) Diptères: Brachycères. II. Muscidae acalypterae, Scatophagidae. Paris: Éditions Faune de France 28 (FdeFr28)Dipt.Brachyceres.pdf Bibliotheque Virtuelle Numerique pdf The larvae feed on Senecio vulgaris.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphenella marginata has left across the world's sequence archives.

At a glance

DNA specimens31

BINs2

Marker genes2

eDNA detections2

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Diversity (π)1.2%

Haplotypes1

BINs2

Where individuals differ — all 49 variable positions, in barcode order

16Tmostly conserved

49Amostly conserved

70Cmostly conserved

82Cmostly conserved

88Gmostly conserved

91Cmostly conserved

100Gmostly conserved

106Cmostly conserved

121Tmostly conserved

130Amostly conserved

136Cmostly conserved

139Tmostly conserved

143Gmostly conserved

145Amostly conserved

178Cmostly conserved

181Amostly conserved

187Cmostly conserved

205Amostly conserved

220Cmostly conserved

223Cmostly conserved

226Cmostly conserved

232Amostly conserved

238Tmostly conserved

256Cmostly conserved

266Cmostly conserved

271Amostly conserved

277Amostly conserved

283Cmostly conserved

295Gmostly conserved

307Tmostly conserved

313Tmostly conserved

317Tmostly conserved

328Tmostly conserved

334Amostly conserved

355Tmostly conserved

356Amostly conserved

359Tmostly conserved

360Cmostly conserved

369Cmostly conserved

370Amostly conserved

373Amostly conserved

382Amostly conserved

385Cmostly conserved

400Tmostly conserved

406Cmostly conserved

407Cmostly conserved

408Tmostly conserved

423Cmostly conserved

646Tmostly conserved

AACTTTATATTTTATTTTTGGAGCTTGAGCAGGAATAATTGGAACTTCATTAAGAATTTTAATTCGAGCCGAATTAGGACACCCAGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphenella sinensissame genus5.4%Dictyotrypeta syssemasame family9.9%Tephritis californicasame family10.3%Tephritis matricariaesame family10.5%Trupanea radiferasame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sphenella marginata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈595 235 565 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sphenella marginata0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.8% BUSCO

08Occurrence & distribution

Record type2 991 records

Wild obs. + sensor2 746

Museum / vouchered245

Origin

Native1

Range

Area of Occupancy AOO6 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 661≤1 km 379≤10 km 1 414>10 km 10

2 464 georeferenced · 282 without coordinates

Open the mapobservation + sensor2 746

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 63≤1 km 44≤10 km 30>10 km 4

141 georeferenced · 104 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KwaZulu-Natal Museumlocation not on record	38
SLU Artdatabankenlocation not on record	28
Stockholm, SE	22
Helsinki, FI	21
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	17
MZLUlocation not on record	17
University of Tokyo, Department of Zoologylocation not on record	14
Natural History Museum Rotterdamlocation not on record	10
DFFW2016location not on record	9
National Museums of Kenyalocation not on record	8
NCMGlocation not on record	8
South Kensington, GB	7
Philadelphia, US	5
DFlocation not on record	4
Tilburg, NL	4
Bavarian State Collection of Zoologylocation not on record	4
Natural History Museum, Londonlocation not on record	4
ZMAAlocation not on record	3
Kuopio, FI	2
neflocation not on record	2
BioFokuslocation not on record	1

21 institutions · 228 of 245 vouchered records shown · 17 without an institution code

09Environmental DNA2 detections

Where the DNA of Sphenella marginata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter18.9 °C

Max temp (day)19.2 °C

Min temp (night)10.1 °C

Precipitation104 mm/mo

Air humidity58.6 %

Moisture balance-13.5 mm/mo

Vapour deficit715 Pa

Wind speed3.20 m/s

Cloud cover35.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphenella marginata

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 991 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 991 records