Sphenarches ontario

(McDunnough, 1927) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Sphenarches

At a glance

Occurrence records153

Data sources8

Biological traits0

DNA specimens19

eDNA detections16

Sources8 archives

Databases and archives Sphenarches ontario's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF153 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD19 specimens

01Narrative

Sphenarches ontario is a moth of the family Pterophoridae that is known from Ontario, Canada. The wingspan is about 14 mm. The larvae feed on the inflorescences of certain grape species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphenarches ontario has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

58Avariable

59Cmostly conserved

103Cmostly conserved

200Gmostly conserved

202Cmostly conserved

212Tmostly conserved

274Cmostly conserved

517Cmostly conserved

542Tmostly conserved

550Amostly conserved

557Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGTACTTCTTTAAGATTACTAATTCGAGCTGAATTAAGAACTCCCAGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.29%

Haplotypes7

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Geina sheppardisame family4.3%Geina busckisame family6.8%Procapperia linariaesame family7.0%Geina didactylasame family7.6%Capperia ningorissame family8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type153 records

Wild obs. + sensor135

Museum / vouchered18

Range

Area of Occupancy AOO508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 59≤1 km 25≤10 km 4>10 km 24

112 georeferenced · 23 without coordinates

Open the mapobservation + sensor135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2>10 km 1

3 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	11
Smithsonian Institution, National Museum of Natural Historylocation not on record	3
Denver, US	1
Cornell University Insect Collectionlocation not on record	1
East Lansing, US	1
SOVTlocation not on record	1

6 institutions · 18 of 18 vouchered records shown

09Environmental DNA16 detections

Where the DNA of Sphenarches ontario was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

ForestfarmMixed habitatGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 17.4–20.4

Seasonal swing summer↔winter30.4 °C

Max temp (day)23.7 °C 22.6–25.5

Min temp (night)13.2 °C 12.8–17.1

Precipitation83.2 mm/mo 82.4–94.2

Air humidity57.3 % 57.3–58.4

Moisture balance-56.6 mm/mo -63.7–-56.1

Vapour deficit898 Pa 844–1,009

Wind speed2.90 m/s 2.90–3.80

Cloud cover44.5 % 40.0–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)