Sphelodon phoxopteridis

(Weed, 1888) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Ichneumonidae/Sphelodon

At a glance

Occurrence records158

Data sources7

Biological traits0

DNA specimens25

eDNA detections21

Sources7 archives

Databases and archives Sphelodon phoxopteridis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF158 records

Environmental DNA1 datasets · 4 countries21 detections

DNA & barcodingBOLD25 specimens

01Narrative

Sphelodon phoxopteridis is a species of parasitoid wasp in the family Ichneumonidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphelodon phoxopteridis has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes1

eDNA detections21

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 86 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

4Tmostly conserved

5Tvariable

6Tmostly conserved

7Tvariable

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Cmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Avariable

23Amostly conserved

24Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

31Amostly conserved

32Gmostly conserved

33Gmostly conserved

34Avariable

37Amostly conserved

38Amostly conserved

39Tmostly conserved

40Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Avariable

47Tmostly conserved

48Cmostly conserved

51Tmostly conserved

53Amostly conserved

54Gmostly conserved

56Tmostly conserved

58Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

66Gmostly conserved

68Tvariable

69Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

79Amostly conserved

80Amostly conserved

81Amostly conserved

83Cmostly conserved

84Cmostly conserved

85Tmostly conserved

86Gvariable

133Cvariable

181Avariable

205Tvariable

220Cvariable

266Tvariable

271Cvariable

298Avariable

307Avariable

316Tvariable

319Avariable

337Tmostly conserved

401Tmostly conserved

412Avariable

415Avariable

445Tvariable

448Cvariable

454Cvariable

478Cvariable

508Cvariable

542Tvariable

550Tvariable

553Avariable

565Tvariable

607Cvariable

614Gmostly conserved

619Cvariable

634Cvariable

AATTTTTTATTTCATTTTTGGAATATGATCAGGAATAATTGGATCATCAATAAGATTAATTATTCGATTAGAATTAGGAAATCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.8%

Haplotypes5

BINs2

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphelodon wardaesame genus8.7%Lissonota foliisame family11.0%Glypta tenuicornissame family12.2%Glypta solidasame family12.2%Glypta davisiisame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type158 records

Wild obs. + sensor83

Museum / vouchered75

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 32≤1 km 23≤10 km 1>10 km 10

66 georeferenced · 17 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	34
OSUClocation not on record	16
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
Lake Placid, US	6
CUlocation not on record	1
Decorah, US	1
Facultad de Ingeniería y Ciencias, Universidad Autónoma de Tamaulipaslocation not on record	1

7 institutions · 66 of 75 vouchered records shown · 9 without an institution code

09Environmental DNA21 detections

Where the DNA of Sphelodon phoxopteridis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map4 countries0

Forest1. Forest & Woodland1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 15.5–25.6

Seasonal swing summer↔winter24.4 °C

Max temp (day)25.6 °C 21.8–29.1

Min temp (night)18.7 °C 11.4–22.3

Precipitation91.6 mm/mo 51.4–419

Air humidity59.9 % 57.0–75.6

Moisture balance-56.6 mm/mo -91.3–289

Vapour deficit855 Pa 714–1,290

Wind speed2.80 m/s 1.40–3.30

Cloud cover38.8 % 24.1–41.4

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)