Sphegina sibirica

Stackelberg, 1953 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Sphegina

At a glance

Occurrence records2 405

Data sources7

Biological traits2

DNA specimens34

eDNA detections34

Sources7 archives

Databases and archives Sphegina sibirica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 405 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 405 records

Environmental DNA2 datasets · 10 countries34 detections

DNA & barcodingBOLD34 specimens

01Narrative

Sphegina sibirica is a species of hoverfly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)saprophagous

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphegina sibirica has left across the world's sequence archives.

At a glance

DNA specimens34

BINs2

Marker genes2

eDNA detections34

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.03%

Haplotypes1

BIN1

AACTTTATATTTTTTATTTGGAACATGAGCAGGAATAGTAGGTACTTCTTTAAGTATTTTAATTCGAGCAGAACTTGGTCATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphegina rufiventrissame genus2.4%Sphegina campanulatasame genus4.6%Sphegina thoraciacasame genus4.9%Sphegina petiolatasame genus5.8%Sphegina sphegineasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S

animal barcoderibosomal

08Occurrence & distribution

Record type2 405 records

Wild obs. + sensor1 625

Museum / vouchered780

Range

Area of Occupancy AOO5 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 041≤1 km 406≤10 km 128>10 km 19

1 594 georeferenced · 31 without coordinates

Open the mapobservation + sensor1 625

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 289≤1 km 383≤10 km 16>10 km 31

719 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence780

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	227
SLU Artdatabankenlocation not on record	104
NHMOlocation not on record	95
Helsinki, FI	86
University of Tokyo, Department of Zoologylocation not on record	40
DFlocation not on record	37
Philadelphia, US	34
Trondheim, NO	15
neflocation not on record	15
BioFokuslocation not on record	9
NTNU-VMlocation not on record	5
Department of Biology and Ecology, Faculty of Sciences, University of Novi Sadlocation not on record	4
Rovaniemi, FI	3
ZSMlocation not on record	2
Tartu, EE	2
Bavarian State Collection of Zoologylocation not on record	2
Gothenburg, SE	1
CBDClocation not on record	1
Uniwersytet Łódzkilocation not on record	1

19 institutions · 683 of 780 vouchered records shown · 97 without an institution code

09Environmental DNA34 detections

Where the DNA of Sphegina sibirica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys2

Countries10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map10 countries0

5. Wetlands (inland) | 5.4. Bogs, marshes, s…1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C -0.7–16.7

Seasonal swing summer↔winter20.0 °C

Max temp (day)16.6 °C 3.30–21.1

Min temp (night)8.90 °C -5.40–12.0

Precipitation91.6 mm/mo 56.0–184

Air humidity60.7 % 57.8–66.1

Moisture balance2.30 mm/mo -51.8–87.4

Vapour deficit574 Pa 226–789

Wind speed2.90 m/s 1.70–4.60

Cloud cover42.0 % 34.4–58.7

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphegina sibirica

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type2 405 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 405 records