Sphegina clunipes

(Fallén, 1816) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Sphegina

At a glance

Occurrence records3 520

Data sources7

Biological traits2

DNA specimens38

eDNA detections136

Sources7 archives

Databases and archives Sphegina clunipes's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 520 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI136 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 520 records

Environmental DNA3 datasets · 10 countries136 detections

DNA & barcodingBOLD38 specimens

01Narrative

Sphegina clunipes is a Palearctic species of hoverfly.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)saprophagous

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphegina clunipes has left across the world's sequence archives.

At a glance

DNA specimens38

BINs1

Marker genes1

eDNA detections136

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

35Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Amostly conserved

47Tmostly conserved

48Cmostly conserved

50Cmostly conserved

61Amostly conserved

263Tmostly conserved

328Gvariable

364Cmostly conserved

481Cmostly conserved

616Tmostly conserved

646Tmostly conserved

AACTTTATACTTTTTATTTGGTACATGAGCAGGAATAGTAGGAACTTCTCTTAGAATCTTAATTCGTGCAGAACTTGGACATCCAGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.93%

Haplotypes4

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphegina verecundasame genus6.4%Sphegina flavomaculatasame genus6.5%Sphegina sphegineasame genus6.7%Sphegina montanasame genus7.6%Sphegina latifronssame genus7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 520 records

Wild obs. + sensor2 362

Museum / vouchered1 157

Other1

Range

Area of Occupancy AOO7 432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 1 428≤1 km 549≤10 km 281>10 km 2

2 260 georeferenced · 102 without coordinates

Open the mapobservation + sensor2 362

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 597≤1 km 429≤10 km 41>10 km 1

1 068 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence1 157

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	315
SLU Artdatabankenlocation not on record	112
NHMOlocation not on record	76
Helsinki, FI	38
CBDClocation not on record	26
NCMGlocation not on record	25
DFlocation not on record	24
Gothenburg, SE	18
Tilburg, NL	16
NSMKlocation not on record	11
DFFW2018location not on record	10
University of Tokyo, Department of Zoologylocation not on record	10
neflocation not on record	9
Trondheim, NO	9
RMZlocation not on record	9
Tromsø, NO	8
Natural History Museum Rotterdamlocation not on record	7
NTNU-VMlocation not on record	6
Rovaniemi, FI	6
MZLUlocation not on record	5
BioFokuslocation not on record	5
Philadelphia, US	4
ZSMlocation not on record	4
Bavarian State Collection of Zoologylocation not on record	4
Uniwersytet Łódzkilocation not on record	4
DFFW2016location not on record	4
NMOKlocation not on record	4
Salzburg, AT	3
South Kensington, GB	3
KwaZulu-Natal Museumlocation not on record	2
UFPRlocation not on record	2
Stockholm, SE	1
Natural History Museum, Londonlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
CIBIOlocation not on record	1

35 institutions · 783 of 1 157 vouchered records shown · 374 without an institution code

09Environmental DNA136 detections

Where the DNA of Sphegina clunipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found136

Studies independent surveys3

Countries10

Verifiable raw sequence linked12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 136 detections have coordinates

Open the map10 countries0

1. Forest & Woodland|1.1. Boreal Forest5. Wetlands (inland) | 5.4. Bogs, marshes, s…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 9.20–15.8

Seasonal swing summer↔winter17.9 °C

Max temp (day)16.1 °C 11.4–19.0

Min temp (night)9.20 °C 3.70–10.7

Precipitation91.6 mm/mo 70.8–127

Air humidity61.9 % 58.8–63.6

Moisture balance2.30 mm/mo -30.9–56.4

Vapour deficit603 Pa 453–685

Wind speed2.20 m/s 2.10–3.80

Cloud cover50.9 % 38.0–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 133 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphegina clunipes

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type3 520 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 520 records