Sphecomyia vittata

(Wiedemann, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Sphecomyia

At a glance

Occurrence records421

Data sources6

Biological traits0

DNA specimens23

eDNA detections14

Sources6 archives

Databases and archives Sphecomyia vittata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF421 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD23 specimens

01Narrative

Sphecomyia vittata ((Wiedemann, 1830 ) , the Long-horned Yellowjacket , is an uncommon species of syrphid fly observed throughout North America, concentrated in the eastern half of the continent.. Hoverflies can remain nearly motionless in flight. The adults are also known as flower flies for they are commonly found on flowers, from which they get both enegy-giving nectar and protein rich pollen. The larvae have been found in sap runs and tree wounds. .

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphecomyia vittata has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes10

eDNA detections14

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

40Avariable

43Amostly conserved

49Cmostly conserved

50Tmostly conserved

52Amostly conserved

79Cmostly conserved

103Tmostly conserved

133Tmostly conserved

145Tmostly conserved

226Tmostly conserved

229Amostly conserved

235Tmostly conserved

386Tmostly conserved

418Amostly conserved

433Amostly conserved

451Tmostly conserved

469Avariable

499Amostly conserved

508Amostly conserved

530Cmostly conserved

542Cmostly conserved

556Amostly conserved

562Avariable

607Tmostly conserved

622Amostly conserved

628Gmostly conserved

634Tvariable

AACATTATATTTTATTTTCGGAACTTGAGCTGGAATAGTAGGAACATCCTTAAGAATTTTAATTCGTGCAGAATTAGGCCATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes6

BINs2

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphecomyia pattoniisame genus5.9%Criorhina verbosasame family7.4%Sterphus genuinussame family7.4%Criorhina nigriventrissame family7.6%Criorhina floccosasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28SAATSCADCK1PERRBM15TULP

animal barcoderibosomalmarker

08Occurrence & distribution

Record type421 records

Wild obs. + sensor369

Museum / vouchered52

Range

Area of Occupancy AOO1 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 173≤1 km 80≤10 km 17>10 km 32

302 georeferenced · 67 without coordinates

Open the mapobservation + sensor369

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 5>10 km 2

9 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	7
Champaign, US	6
University of Guelphlocation not on record	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
University of Nebraska State Museumlocation not on record	4
WIlocation not on record	3
Toronto, CA	3
CUlocation not on record	2
Montgomery, US	2
Saint John, CA	2
Wuzhou, CN	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Georgia Museum of Natural Historylocation not on record	1

13 institutions · 40 of 52 vouchered records shown · 12 without an institution code

09Environmental DNA14 detections

Where the DNA of Sphecomyia vittata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

At flowering Acer spicatumA2. In copula with A1 on flowers of Prunus s…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 11.6–18.9

Seasonal swing summer↔winter27.2 °C

Max temp (day)22.2 °C 15.9–23.8

Min temp (night)10.8 °C 7.20–14.7

Precipitation88.6 mm/mo 82.9–115

Air humidity57.0 % 54.7–58.9

Moisture balance-33.7 mm/mo -55.3–-22.6

Vapour deficit860 Pa 580–977

Wind speed2.80 m/s 2.30–3.90

Cloud cover44.1 % 40.0–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)