Sphecodes davisii

Robertson, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Sphecodes

At a glance

Occurrence records629

Data sources6

Biological traits0

DNA specimens30

eDNA detections0

Sources6 archives

Databases and archives Sphecodes davisii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility629 records↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF629 records

DNA & barcodingBOLD30 specimens

01Narrative

Sphecodes davisii is a species of sweat bee in the family Halictidae.Sharkey M.J. (2007). Phylogeny and Classification of Hymenoptera."Phylogenetic relationships among superfamilies of Hymenoptera", Sharkey M.J., Carpenter J.M., Vilhelmsen L., et al. 2012. Cladistics 28(1): 80-112.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphecodes davisii has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

22Amostly conserved

142Tmostly conserved

197Cmostly conserved

235Tmostly conserved

241Amostly conserved

293Tmostly conserved

385Cmostly conserved

472Cmostly conserved

508Gmostly conserved

532Cmostly conserved

595Tmostly conserved

622Amostly conserved

AATATTATATTTTATTTTTGCAATATGAGCTGGTATAATTGGAGCTTCATTAAGTATAATTATTCGTATAGAATTAAGAATTCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.37%

Haplotypes3

BIN1

Most divergent pair2.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphecodes townesisame genus8.4%Sphecodes puncticepssame genus9.3%Sphecodes pellucidussame genus10.0%Sphecodes olympicussame genus10.3%Sphecodes dusmetisame genus10.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type629 records

Wild obs. + sensor97

Museum / vouchered532

Range

Area of Occupancy AOO1 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 48≤1 km 16≤10 km 2>10 km 7

73 georeferenced · 24 without coordinates

Open the mapobservation + sensor97

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 31≤1 km 94≤10 km 27>10 km 10

162 georeferenced · 370 without coordinates

Open the institutions mapphysical evidence532

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	107
	100
US	65
Cambridge, US	58
White River Junction, US	58
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	16
New Haven, US	14
Toronto, CA	10
UNHClocation not on record	10
Champaign, US	6
LULlocation not on record	5
Cornell University Insect Collectionlocation not on record	5
Beltsville, US	4
Middlebury Collegelocation not on record	4
Chicago, US	3
New Haven, US	2
Decorah, US	1
FWSlocation not on record	1
Toronto, CA	1

19 institutions · 470 of 532 vouchered records shown · 62 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)