Sphecodes confertus

Say, 1837 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Sphecodes

At a glance

Occurrence records513

Data sources7

Biological traits1

DNA specimens8

eDNA detections8

Sources7 archives

Databases and archives Sphecodes confertus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility513 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF513 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Sphecodes confertus is a species of sweat bee in the family Halictidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.5 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphecodes confertus has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.18%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

235Tmostly conserved

460Avariable

613Cmostly conserved

TATATTATATTTTATTTTTGCAATATGAGCCGGCATAATTGGTGCTTCTTTAAGAATAATTATTCGAATAGAATTAAGTATTCCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphecodes olympicussame genus4.4%Sphecodes puncticepssame genus8.1%Sphecodes longulussame genus9.0%Sphecodes ruficrussame genus10.5%Sphecodes persimilissame genus10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type513 records

Wild obs. + sensor16

Museum / vouchered497

Range

Area of Occupancy AOO700 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 7≤1 km 7≤10 km 1>10 km 1

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 4≤1 km 88≤10 km 140>10 km 8

240 georeferenced · 257 without coordinates

Open the institutions mapphysical evidence497

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WIlocation not on record	153
Cornell University Insect Collectionlocation not on record	82
Champaign, US	66
	37
New Haven, US	20
North Carolina State University Insect Museumlocation not on record	14
White River Junction, US	12
New Haven, US	10
Beltsville, US	6
US	6
Chicago, US	5
Wuzhou, CN	3
Essig Museum of Entomologylocation not on record	2
Cambridge, US	1
76location not on record	1
Colorado State Universitylocation not on record	1
UNHClocation not on record	1

17 institutions · 420 of 497 vouchered records shown · 77 without an institution code

09Environmental DNA8 detections

Where the DNA of Sphecodes confertus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Active dune

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 3.80–21.8

Seasonal swing summer↔winter30.0 °C

Max temp (day)25.2 °C 8.50–25.8

Min temp (night)13.7 °C 0.4–18.9

Precipitation73.0 mm/mo 48.8–95.9

Air humidity58.2 % 53.0–62.6

Moisture balance-82.1 mm/mo -93.4–-30.0

Vapour deficit945 Pa 507–1,117

Wind speed4.20 m/s 4.00–5.70

Cloud cover38.5 % 34.7–50.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)