Sphecodes aroniae

Mitchell, 1960 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Halictidae/Sphecodes

At a glance

Occurrence records175

Data sources7

Biological traits0

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Sphecodes aroniae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF175 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD4 specimens

01Narrative

Sphecodes aroniae is a species of sweat bee in the family Halictidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphecodes aroniae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.

Diversity (π)7.9%

Haplotypes1

BINs2

Where individuals differ — all 103 variable positions, in barcode order

10Tmostly conserved

14Amostly conserved

16Tmostly conserved

22Tmostly conserved

29Tmostly conserved

31Cmostly conserved

50Cmostly conserved

52Tmostly conserved

74Tmostly conserved

76Amostly conserved

80Tmostly conserved

81Gmostly conserved

85Tmostly conserved

88Tmostly conserved

89Gmostly conserved

90Cmostly conserved

115Cmostly conserved

122Amostly conserved

124Cmostly conserved

130Tmostly conserved

136Cmostly conserved

139Tmostly conserved

142Cmostly conserved

181Amostly conserved

184Tmostly conserved

200Gmostly conserved

202Cmostly conserved

205Amostly conserved

217Amostly conserved

223Tmostly conserved

241Tmostly conserved

259Cmostly conserved

269Cmostly conserved

277Amostly conserved

281Cmostly conserved

286Gmostly conserved

293Amostly conserved

299Gmostly conserved

301Tmostly conserved

305Tmostly conserved

306Tmostly conserved

309Gmostly conserved

311Gmostly conserved

316Tmostly conserved

317Amostly conserved

322Tmostly conserved

325Tmostly conserved

328Amostly conserved

335Amostly conserved

340Tmostly conserved

343Amostly conserved

347Tmostly conserved

355Cmostly conserved

356Tmostly conserved

361Tmostly conserved

367Cmostly conserved

370Tmostly conserved

379Amostly conserved

380Amostly conserved

382Amostly conserved

387Tmostly conserved

391Tmostly conserved

397Cmostly conserved

400Amostly conserved

401Cmostly conserved

403Tmostly conserved

418Cmostly conserved

421Tmostly conserved

424Tmostly conserved

436Tmostly conserved

439Cmostly conserved

442Tmostly conserved

450Cmostly conserved

452Tmostly conserved

460Tmostly conserved

461Cmostly conserved

463Tmostly conserved

478Tmostly conserved

479Amostly conserved

484Tmostly conserved

500Tmostly conserved

508Amostly conserved

514Amostly conserved

526Amostly conserved

547Amostly conserved

553Tmostly conserved

556Amostly conserved

562Cmostly conserved

565Amostly conserved

574Amostly conserved

586Tmostly conserved

596Cmostly conserved

598Tmostly conserved

601Cmostly conserved

604Amostly conserved

607Tmostly conserved

616Cmostly conserved

619Cmostly conserved

622Amostly conserved

628Amostly conserved

631Tvariable

637Tmostly conserved

645Tmostly conserved

TATATTATATTTTATTTTTGCTATATGATCCGGAATAATTGGAGCTTCTCTTAGTATAATTATTCGAATAGAATTAAGATGTCCTGGTGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphecodes pecosensissame genus3.3%Sphecodes rhoissame genus4.1%Sphecodes ranunculisame genus4.1%Sphecodes spinulosussame genus11.9%Sphecodes kincaidiisame genus12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type175 records

Wild obs. + sensor19

Museum / vouchered156

Range

Area of Occupancy AOO380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 11≤1 km 1≤10 km 1>10 km 4

17 georeferenced · 2 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤1 km 14≤10 km 4

18 georeferenced · 138 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
US	43
	41
Cornell University Insect Collectionlocation not on record	9
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Beltsville, US	8
North Carolina State University Insect Museumlocation not on record	6
New Haven, US	5
LULlocation not on record	4
Champaign, US	4
WIlocation not on record	3
Chicago, US	2
UNHClocation not on record	2
FWSlocation not on record	2
Lexington, US	1
White River Junction, US	1
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	1
New Haven, US	1
Cambridge, US	1
Wuzhou, CN	1
JBWM, MSUClocation not on record	1

20 institutions · 144 of 156 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Sphecodes aroniae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 21.2–21.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)26.8 °C

Min temp (night)16.6 °C

Precipitation132 mm/mo

Air humidity59.4 %

Moisture balance-16.9 mm/mo

Vapour deficit1,022 Pa

Wind speed2.90 m/s

Cloud cover39.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)