Sphagnum denticulatum

Brid. · species

image placeholder — illustration coming later

Plantae/Bryophyta/Sphagnopsida/Sphagnales/Sphagnaceae/Sphagnum

At a glance

Occurrence records10 131

Data sources9

Biological traits1

DNA specimens33

eDNA detections29

Sources9 archives

Databases and archives Sphagnum denticulatum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF10 131 records

Environmental DNA1 datasets · 1 countries29 detections

DNA & barcodingBOLD · NCBI33 specimens

Genome at a glanceGoaT546 Mbp

01Narrative

Sphagnum denticulatum is a species of moss belonging to the family Sphagnaceae. It is widely distributed in Europe but it is also found in other parts of the world. In a study of the effect of the herbicide Asulam on moss growth, Sphagnum denticulatum was shown to be the third most sensitive to the herbicide out of the 18 species tested. The study concluded that it was sensitive to Asulam exposure.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formnonvascular

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphagnum denticulatum has left across the world's sequence archives.

At a glance

DNA specimens33

Marker genes5

GenBank sequences10

eDNA detections29

Countries6

The DNA barcodea real sequence read deposited for this species

ITSKY775326.1 ↗750 bpPoland

ACGT

TTGCACACACAGAGCAGTAAACCCTGCGAACACGCTTTCGTCCTCCCGGGCCCCGCGTGCGGGCGGGGAGCGGCCCTCGCGGTCGCGCCT …

Sphagnum denticulatum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★trnL★ITS6trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Sphagnum denticulatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size545 724 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Sphagnum denticulatum0.55 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy2× diploid · measured

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type10 131 records

Wild obs. + sensor8 303

Museum / vouchered1 828

Range

Area of Occupancy AOO14 292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 579≤1 km 2 063≤10 km 1 985>10 km 16

4 643 georeferenced · 3 660 without coordinates

Open the mapobservation + sensor8 303

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 298≤1 km 849≤10 km 120>10 km 52

1 319 georeferenced · 509 without coordinates

Open the institutions mapphysical evidence1 828

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Trondheim, NO	543
Brussel, BE	261
Tilburg, NL	159
Olocation not on record	128
MAlocation not on record	122
Frankfurt am Main	112
SLU Artdatabankenlocation not on record	50
TROMlocation not on record	46
Universidad de Oviedolocation not on record	43
Durham, US	36
Saint Louis, US	33
Garðabær, IS	32
Madrid, ES	19
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	13
Natural History Museum Rotterdamlocation not on record	13
MeiseBGlocation not on record	9
Paris, FR	8
Moscow State Universitylocation not on record	8
SZUlocation not on record	7
John May Museum of Natural Historylocation not on record	6
Salamanca, ES	5
University of Gdansklocation not on record	4
South Kensington, GB	4
Royal Botanic Garden Edinburghlocation not on record	3
BRNUlocation not on record	2
Philadelphia, US	2
Universidad de Málagalocation not on record	1
Senckenberg Institute for Plant Form and Function at Friedrich Schiller University Jenalocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
IFR-DNFlocation not on record	1
Dresden, DE	1
Université Lavallocation not on record	1
Stockholm, SE	1
Göteborg, SE	1
Bronx, US	1

35 institutions · 1 677 of 1 828 vouchered records shown · 151 without an institution code

09Environmental DNA29 detections

Where the DNA of Sphagnum denticulatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map1 country0

W-facing rocky riverbank; over shaded rocks …Open moorland valley; on muddy flushed track

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 6.80–11.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)11.3 °C 8.90–13.7

Min temp (night)5.00 °C 2.60–7.40

Precipitation136 mm/mo 133–138

Air humidity68.0 % 65.6–70.4

Moisture balance55.5 mm/mo 52.2–58.8

Vapour deficit370 Pa 341–399

Wind speed6.10 m/s 5.60–6.70

Cloud cover50.6 % 50.3–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphagnum denticulatum

At a glance

Sources9 archives

Habitat & environment1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type10 131 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 131 records