Sphaerosporella brunnea

(Alb. & Schwein.) Svrček & Kubička · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Pyronemataceae/Sphaerosporella

At a glance

Occurrence records293

Data sources9

Biological traits0

DNA specimens9

eDNA detections29

Sources9 archives

Databases and archives Sphaerosporella brunnea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility293 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF293 records

Environmental DNA4 datasets · 5 countries29 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaT · NCBI52 Mbp

01Narrative

Sphaerosporélla brúnnea (лат.) — вид грибов-дискомицетов, относящийся к роду Sphaerosporella семейства Пиронемовые (Pyronemataceae). Типовой вид рода.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaerosporella brunnea has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections29

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPV188598.1 ↗416 bpCanada · 2019

ACGT

TAAAAGTAATAAGTGCTCCCGGCGCGTATTATGTAACCCATCTGTGTATCTTACCTGTTGCTTCCGTGGGTCGTTGGCTTCGGCCACTCC …

Sphaerosporella brunnea isolate I4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Sphaerosporella brunnea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size51 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Sphaerosporella brunnea0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness93.7% BUSCO

08Occurrence & distribution

Record type293 records

Wild obs. + sensor136

Museum / vouchered154

Other3

Origin

Native4

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 15≤1 km 15≤10 km 97>10 km 1

128 georeferenced · 8 without coordinates

Open the mapobservation + sensor136

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 10≤1 km 27≤10 km 21>10 km 1

59 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence154

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Trondheim, NO	14
Berlin, DE	14
Copenhagen, DK	13
Tartu, EE	8
Olocation not on record	6
FLASlocation not on record	6
TROMlocation not on record	5
Karlsruhe, DE	4
Kew, GB	4
San Sebastián, ES	3
MeiseBGlocation not on record	3
Ann Arbor, US	3
Catholic University of Pekinglocation not on record	3
WU-MYClocation not on record	3
Université de Montréal Biodiversity Centrelocation not on record	3
Tilburg, NL	3
CA	2
TENN-Flocation not on record	2
Görlitz, DE	2
UAclocation not on record	1
Uppsala, SE	1
Vitoria, ES	1
Nagatoro-machi, Chichibu-gun, JP	1
nsnflocation not on record	1
BDBClocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Fort Hayslocation not on record	1
Acadia Universitylocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Auckland, NZ	1
Göteborg, SE	1
Bardejov, SK	1
Bando, JP	1

33 institutions · 115 of 154 vouchered records shown · 39 without an institution code

09Environmental DNA29 detections

Where the DNA of Sphaerosporella brunnea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys4

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map5 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 5.80–17.4

Seasonal swing summer↔winter21.9 °C

Max temp (day)20.5 °C 8.40–21.6

Min temp (night)13.6 °C 2.50–14.5

Precipitation77.6 mm/mo 61.2–87.9

Air humidity60.1 % 58.8–64.5

Moisture balance-20.3 mm/mo -36.3–18.0

Vapour deficit790 Pa 385–794

Wind speed2.90 m/s 2.40–3.60

Cloud cover39.4 % 38.6–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)