Sphaeropteris feani

(E.D.Br.) R.M.Tryon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Cyatheales/Cyatheaceae/Sphaeropteris

At a glance

Occurrence records13

Data sources6

Biological traits1

DNA specimens4

eDNA detections2

Sources6 archives

Databases and archives Sphaeropteris feani's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Sphaeropteris feani là một loài dương xỉ trong họ Cyatheaceae. Loài này được R.M.Tryon mô tả khoa học đầu tiên năm 1970. Danh pháp khoa học của loài này chưa được làm sáng tỏ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Habitat & environment1

Climatewet tropical

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaeropteris feani has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMT216117.1 ↗1 309 bpFrench Polynesia · 2017

ACGT

AGGTGTTGGATTCAAAGCTGGTGTTAAAGATTATCGATTGACCTATTACACTCCCAAGTATGAGACCAAAGACACCGATATCTTGGCAGC …

Sphaeropteris feani voucher US:Schuettpelz1928 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type13 records

Wild obs. + sensor5

Museum / vouchered8

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 3

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Stellenboschlocation not on record	6
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

2 institutions · 7 of 8 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Sphaeropteris feani was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.5 °C 26.5–26.5

Seasonal swing summer↔winter1.40 °C

Max temp (day)27.1 °C

Min temp (night)25.7 °C

Precipitation218 mm/mo

Air humidity61.1 %

Vapour deficit1,339 Pa

Cloud cover18.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)