Sphaerolobium medium

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Sphaerolobium

At a glance

Occurrence records791

Data sources9

Biological traits21

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Sphaerolobium medium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility791 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF791 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Sphaerolobium medium là một loài thực vật có hoa trong họ Đậu. Loài này được R.Br. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Plant height0.6 m

Plant height max0.6 m

Plant height min0.1 m

Seed mass0.96 mg

Life cycle & reproduction5

Flowering timennnnyyyyyynn

Life spanperennial

Reproductive maturity1.92 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaerolobium medium has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAF287660.1 ↗685 bp

ACGT

GTGAACCTGCGGAAGGATCATTGTCAATGCCTCACAAGCAGCTAAACCCGTGAATGTGTTTTTCTATTTAAGGTTGGTTTGCAGTGTTTA …

Sphaerolobium medium small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sphaerolobium medium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.848 ↗

08Occurrence & distribution

Record type791 records

Wild obs. + sensor261

Museum / vouchered529

Cultivated / captive1

Origin

Native48

Range

Area of Occupancy AOO2 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 138≤1 km 48≤10 km 16>10 km 12

214 georeferenced · 47 without coordinates

Open the mapobservation + sensor261

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 100≤1 km 27≤10 km 275>10 km 53

455 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence529

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	277
Museo Entomologico de Leonlocation not on record	108
Canberra, AU	55
Mount Annan, AU	49
Adelaide, AU	26
BGPAlocation not on record	6
Brisbane, AU	3
Kew, GB	2
Hobart, AU	1
Claremont, US	1
LDlocation not on record	1

11 institutions · 529 of 529 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Sphaerolobium medium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)