Sphaeranthus indicus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Sphaeranthus

At a glance

Occurrence records663

Data sources8

Biological traits26

DNA specimens9

eDNA detections7

Sources8 archives

Databases and archives Sphaeranthus indicus's data was compiled from.

GBIFGlobal Biodiversity Information Facility663 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources26 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF663 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Fruit length1.2 mm

Leaf length47.5 mm

Leaf width16 mm

Plant height0.45 m

Seed mass0.176 mg

Life cycle & reproduction7

Dispersal typewind

Flowering timennnnyyynnnnn

Life formannual

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation mean850 m

Elevation min600 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf shapenarrowly_elliptical obovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Sphaeranthus indicus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Dicarboxylic acids5

Cinnamic acids and derivatives1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
2-Oxopentanedioic acid	present	NPASS
3-(4-Methoxyphenyl)-2-propenal	present	NPASS
Aconitic Acid	present	NPASS
AFDXODALSZRGIH-QPJJXVBHSA-M	present	NPASS
fumarate	present	NPASS
Fumaric acid	present	NPASS
OPKRDZWOEPBNBL-KQYNXXCUSA-N	present	NPASS
Succinic acid	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaeranthus indicus has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR400887.1 ↗200 bpCanada · 2022

ACGT

CCCGAGAACCTGTACAAACTGTTTGGTGTCACATGGGTCAGGCTTATGTCTGATTGTTGTGTCACCTTTGTTGATTTGCCATCCATGGCT …

Sphaeranthus indicus isolate FM31_Flower internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL7★rbcLa★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type663 records

Wild obs. + sensor321

Museum / vouchered305

Cultivated / captive1

Other36

Origin

Native34

Range

Area of Occupancy AOO2 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 111≤1 km 36≤10 km 19>10 km 4

170 georeferenced · 151 without coordinates

Open the mapobservation + sensor321

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 74≤1 km 28≤10 km 96>10 km 55

253 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence305

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	85
Palmerston, AU	52
Canberra, AU	29
Museo Entomologico de Leonlocation not on record	26
Adelaide, AU	21
Mount Annan, AU	18
Kensington, AU	13
Kunming, CN	7
Natural History Museum, Tribhuvan Universitylocation not on record	7
Herbarium of the Department of Botany, University of Tokyolocation not on record	6
Smithfield, AU	6
Pondicherry, IN	4
John T. Waterhouse Herbariumlocation not on record	3
Dehra Dun, IN	2
University of Stellenboschlocation not on record	2
James Cook Townsvillelocation not on record	2
Kew, GB	2
Baroda, IN	2
Canadian Department of Agriculturelocation not on record	1
Armidale, AU	1
Qarshi Botanical Gardenlocation not on record	1
Honolulu, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	1
Jinghong, CN	1
Bronx, US	1

26 institutions · 295 of 305 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Sphaeranthus indicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 9.90–24.2

Seasonal swing summer↔winter14.1 °C

Max temp (day)26.6 °C 14.3–30.8

Min temp (night)15.2 °C 3.90–17.9

Precipitation39.6 mm/mo 15.0–41.0

Air humidity48.4 % 46.5–55.6

Moisture balance-99.1 mm/mo -111–-23.9

Vapour deficit1,368 Pa 612–1,621

Wind speed2.40 m/s 1.40–2.90

Cloud cover27.2 % 10.8–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)