Sphaeralcea incana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Sphaeralcea

At a glance

Occurrence records320

Data sources11

Biological traits5

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Sphaeralcea incana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility320 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF320 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Sphaeralcea incana, with the common names gray globemallow and soft globemallow, is a desert plant in the mallow family (Malvaceae).USDA: Sphaeralcea incana . accessed 4.5.2015Native Plant Network: Sphaeralcea incana

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphaeralcea incana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF271204.1 ↗672 bp

ACGT

TCGAAACCTGCCTAGCAGAACGACCCGTGAACGTGATATCAAACAACTCCACGAGGGGGTGCGGATGCATCCTTGCCCCGAACCCCCTCG …

Sphaeralcea incana isolate 2 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Sphaeralcea incana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. & R. Spellenberg. 1988. Chromosome counts of angiosperms from New Mexico and adjacent areas. Phytologia 64: 390–398.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type320 records

Wild obs. + sensor121

Museum / vouchered199

Range

Area of Occupancy AOO1 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 62≤1 km 12≤10 km 2>10 km 20

96 georeferenced · 25 without coordinates

Open the mapobservation + sensor121

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 20≤1 km 22≤10 km 39>10 km 19

100 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	48
Bronx, US	38
EL PASO, US	30
Austin, US	13
Phoenix, US	8
Mexico City, MX	8
Flagstaff, US	6
Mexico City, MX	6
Lubbock, US	6
ASUlocation not on record	5
Riverside, US	4
Wuzhou, CN	3
San Angelo, US	3
Hermosillo, MX	3
Bloomington, US	2
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	2
Saint Louis, US	2
Chicago, US	1
Chongqing Museumlocation not on record	1
Guasave, MX	1
Denver, US	1
Bangkok, TH	1
Austin, US	1
Fort Worth, US	1
Tempe, US	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Burlington, US	1
Pullman, US	1

28 institutions · 198 of 199 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Sphaeralcea incana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.