Spermophora senoculata

(Dugès, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Pholcidae/Spermophora

At a glance

Occurrence records892

Data sources8

Biological traits8

DNA specimens10

eDNA detections7

Sources8 archives

Databases and archives Spermophora senoculata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility892 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

World Spider Trait DBMasaryk University8 traits · 5 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources8 traits

Occurrence & distributionGBIF892 records

Environmental DNA1 datasets · 4 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Spermophora senoculata, the shortbodied cellar spider, is a species of cellar spider in the family Pholcidae. It is found in Near East, and it has been introduced into the USA, southern Europe, China, Korea, and Japan.Dean DA (2016). "Catalogue of Texas spiders". ZooKeys 570: 1-703.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesMichalik & Ramirez 2014Mammola et al. 2021ULRS 2002Mammola et al. 2018Huber & Eberle 2021

Morphometry2

Cephalothorax width0.827 mm

Egg size0.474 mm

Ecology3

MicrohabitatCave entrance (twilight zone)

Regional non-IUCN Red List categoryRare (R)

Subterranean affinityTroglophile

Reproduction2

Eggsac shaperound-oval

Number of eggs/sac19 mm

Anatomy1

Sperm transfer formcleistospermia

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spermophora senoculata has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes2

eDNA detections7

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 78% of positions are identical in every specimen.

Where individuals differ — all 145 variable positions, in barcode order

13Tmostly conserved

15Gmostly conserved

16Tmostly conserved

18Tmostly conserved

19Gmostly conserved

20Gmostly conserved

21Gmostly conserved

24Cmostly conserved

26Gmostly conserved

27Gvariable

28Tmostly conserved

30Tmostly conserved

31Gmostly conserved

32Cmostly conserved

33Cvariable

34Amostly conserved

36Amostly conserved

38Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Gvariable

43Amostly conserved

46Gmostly conserved

47Cmostly conserved

48Amostly conserved

49Tmostly conserved

50Tmostly conserved

51Amostly conserved

52Amostly conserved

53Gmostly conserved

54Avariable

55Gmostly conserved

58Tmostly conserved

60Gmostly conserved

61Amostly conserved

62Tmostly conserved

63Tmostly conserved

64Cmostly conserved

65Gmostly conserved

66Gmostly conserved

68Tmostly conserved

69Tmostly conserved

70Gmostly conserved

71Amostly conserved

73Tvariable

74Tmostly conserved

75Gvariable

76Gmostly conserved

77Gmostly conserved

78Tmostly conserved

79Cmostly conserved

80Amostly conserved

81Avariable

82Amostly conserved

83Tmostly conserved

84Tmostly conserved

85Gmostly conserved

87Cvariable

88Amostly conserved

89Gmostly conserved

90Amostly conserved

93Gmostly conserved

94Tmostly conserved

95Tmostly conserved

96Gmostly conserved

98Gmostly conserved

99Gmostly conserved

120Cvariable

129Amostly conserved

132Tmostly conserved

141Amostly conserved

142Gmostly conserved

159Amostly conserved

165Amostly conserved

168Gmostly conserved

180Cmostly conserved

183Gmostly conserved

196Cmostly conserved

198Amostly conserved

204Tmostly conserved

205Tmostly conserved

207Amostly conserved

216Gmostly conserved

219Amostly conserved

222Amostly conserved

228Gmostly conserved

240Amostly conserved

243Gmostly conserved

249Tmostly conserved

252Amostly conserved

261Amostly conserved

262Tmostly conserved

264Amostly conserved

265Tmostly conserved

267Gmostly conserved

270Tmostly conserved

281Tmostly conserved

285Gmostly conserved

289Tmostly conserved

291Gmostly conserved

300Tmostly conserved

303Amostly conserved

312Tmostly conserved

315Amostly conserved

321Gmostly conserved

327Gmostly conserved

345Tmostly conserved

346Cmostly conserved

348Amostly conserved

354Cmostly conserved

356Amostly conserved

369Amostly conserved

374Cmostly conserved

402Amostly conserved

405Cmostly conserved

406Cmostly conserved

417Amostly conserved

444Cmostly conserved

447Tmostly conserved

453Tmostly conserved

+25 more variable positions not shown

ACTTTGTATTTTTTGTTTGGGGCCTGGTCTGCCATAGTGGGGACAGCATTAAGAGTGTTGATTCGGGTTGAGTTGGGTCAAATTGGCAGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.4%

Haplotypes4

BINs2

Most divergent pair13.6%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metagonia conicasame family13.9%Tegenaria percuriosasame order16.5%Kryptonesticus arenstorffisame order16.8%Crustulina stictasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type892 records

Wild obs. + sensor802

Museum / vouchered89

Other1

Origin

Native2

Range

Area of Occupancy AOO2 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 251≤1 km 83≤10 km 130>10 km 121

585 georeferenced · 217 without coordinates

Open the mapobservation + sensor802

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 3≤10 km 21>10 km 9

33 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence89

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	17
NSMKlocation not on record	7
Bonn, DE	5
Iwate Prefectural Museumlocation not on record	3
Champaign, US	3
Frankfurt am Main	3
Albuquerque, US	2
Ohio State University Acarology Laboratorylocation not on record	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1
Rifconlocation not on record	1
Chicago, US	1

11 institutions · 44 of 89 vouchered records shown · 45 without an institution code

09Environmental DNA7 detections

Where the DNA of Spermophora senoculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C -0.2–15.5

Seasonal swing summer↔winter23.3 °C

Max temp (day)15.9 °C 1.90–18.7

Min temp (night)6.10 °C -5.10–12.8

Precipitation50.1 mm/mo 28.9–334

Air humidity56.2 % 47.9–66.4

Moisture balance-59.4 mm/mo -86.2–280

Vapour deficit715 Pa 257–896

Wind speed3.40 m/s 2.50–5.20

Cloud cover39.9 % 30.1–56.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)