Spergularia tasmanica

(Kindb.) L.G.Adams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Spergularia

At a glance

Occurrence records815

Data sources4

Biological traits31

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Spergularia tasmanica's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility815 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF815 records

DNA & barcodingNCBIsequences

01Narrative

Spergularia tasmanica is a species of flowering plant from the genus Spergularia. The species was originally described by L.G.Adams in 2008

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology10

Fruit length7.5 mm

Leaf length35 mm

Leaf length max80 mm

Leaf length min10 mm

Leaf width1.5 mm

Leaf width max2 mm

Leaf width min1 mm

Seed length0.8 mm

Seed mass0.097 mg

Seed width0.8 mm

Life cycle & reproduction8

Dehiscencedehiscent

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life spanperennial

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spergularia tasmanica has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX286068.1 ↗616 bpAustralia · 2002

ACGT

CCCGCAGAACGACCCGTGAACTTGTTCATCGTGCATGGGCGCGCCGGTCTTTTGGCCGGCAACCCCAGCCCTGGTGCGCCCGCTCTAACG …

Spergularia tasmanica isolate CAR878 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type815 records

Wild obs. + sensor350

Museum / vouchered465

Origin

Native70

Introduced1

Range

Area of Occupancy AOO2 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 173≤1 km 94≤10 km 71>10 km 1

339 georeferenced · 11 without coordinates

Open the mapobservation + sensor350

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 52≤1 km 117≤10 km 172>10 km 23

364 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence465

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	108
Adelaide, AU	99
Auckland, NZ	91
Hobart, AU	60
Canberra, AU	31
Mount Annan, AU	30
Kensington, AU	13
Brisbane, AU	5
Rotorua, NZ	5
Christchurch, NZ	5
QVMAGlocation not on record	5
Berlin, DE	4
John T. Waterhouse Herbariumlocation not on record	3
Wollongong, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Wlocation not on record	1
Batemans Bay, AU	1

17 institutions · 463 of 465 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)