Spergularia rubra
(L.) J.Presl & C.Presl · speciesAt a glance
Occurrence records111 309
Data sources13
Biological traits66
DNA specimens44
eDNA detections21
Sources13 archives
Databases and archives Spergularia rubra's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility111 309 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Chemical compositionLOTUS4 compounds
Occurrence & distributionGBIF111 309 records
Environmental DNA1 datasets · 6 countries21 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB · GoaT528 Mbp
01Narrative
Spergularia rubra, the red sandspurry or red sand-spurrey, is a plant species in the family Caryophyllaceae. It is native to Europe, Asia and North Africa, and it is present on other continents, including North and South America and Australia, as an introduced species and in many areas a common weed. It grows in a wide variety of habitat types. It is an annual or perennial herb producing a slender, glandular stem up to about 25 centimeters long. It is lined with slightly fleshy linear or threadlike leaves each under 2 centimeters long. The leaves may be tipped with hard points or spines, and they are accompanied by shiny white lance-shaped stipules. Flowers occur in the leaf axils and at the tips of the stems. They have hairy, glandular sepals and five round-oval pink petals.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length4.75 mm
Leaf length10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 12.5 mm
Leaf length max20 mm
Leaf length min5 mm
Leaf mass0.822 mg
Leaf size17.47 mm²
⚠ sources differ — TRY: 17.47 mm² · LEDA: 14 mm² · GIFT: 14.0 mm²
Leaf width1 mm
Leaf width max1.5 mm
Leaf width min0.4 mm
Plant height0.144 m
⚠ sources differ — GIFT: 0.144 m · AusTraits: 0.3 m · LEDA: 0.12 m · TRY: 0.08 m
Plant height generative0.145 m
Plant height max0.3 m
Plant height min0.04 m
Seed length0.44 mm
⚠ sources differ — TRY: 0.44 mm · AusTraits: 0.525 mm · GIFT: 0.5 mm
Seed length max0.5 mm
Seed length min0.5 mm
Seed mass0.03 mg
⚠ sources differ — TRY: 0.03 mg · AusTraits: 0.044 mg · LEDA: 0.029 mg · GIFT: 0.032 mg
Seed mass max0.133 mg
Seed mass min0 mg
Seed volume0.057 mm³
Seed volume max0.057 mm³
Seed volume min0.057 mm³
Seed width0.5 mm
Life cycle & reproduction17
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typewind
⚠ sources differ — AusTraits: anemochory · LEDA: endozoochor · GIFT: anemochorous
Flowering endOct
Flowering startMay
Flowering timeynnnnnnnyyyy
Life formannual or perennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial short_lived_perennial · LEDA: annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Seed number3 150 400
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max840 m
Elevation mean840 m
Elevation min840 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapefiliform linear
Mycorrhiza type0.006268962
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)135 mg/g
Leaf n27.1 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)12.29 mm²/mg
⚠ sources differ — TRY: 12.29 mm²/mg · LEDA: 21.3 mm²/mg · GIFT: 16.79 mm²/mg
Other traits3
Diaspore typeone-seeded generative dispersule
Plant support typefree-standing
Shoot orientationerect
03Chemical composition4 compounds
Compounds documented for Spergularia rubra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavones4
Documented compounds4 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 5,7-Dihydroxy-2-(4-hydroxyphenyl)-6-(3,4,5-trihydroxyoxan-2-yl)chromen-4-one | present | LOTUS | |
| 5-Hydroxy-2-(4-hydroxyphenyl)-7-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-(3,4,5-trihydroxyoxan-2-yl)chromen-4-one | present | LOTUS | |
| 6-[4,5-Dihydroxy-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]-5-hydroxy-2-(4-hydroxyphenyl)-7-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| chrysoeriol 6-C-hexoside-8-C-hexoside | present | LOTUS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Spergularia rubra has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes7
GenBank sequences10
eDNA detections21
Countries8
The DNA barcodea real sequence read deposited for this species
TTAACAATAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGA …
Spergularia rubra voucher KS23 HER0298 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL2★rbcLa★trnL-F★ITS6★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Spergularia rubra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size528 120 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Spergularia rubra0.53 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records18–542n range36median36mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3640×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · brit-fl — Ratter, J.A. Notes Roy. Bot. Gard. Edinburgh 25: 293-302 (1964)
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1956
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Petrova, A. 1995. Mediterranean chromosome number reports 5 (415--434). Fl. Medit. 5: 279–288.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, I. Ruzicka & B. Dadakova. 1979. In IOPB chromosome number ! reports LXIV. Taxon 28: 391–392.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, R. Kurka, I. Ruzicka & B. Dadakova. 1980. In Chromosome number reports LXVIII. Taxon 29: 544.
CCDB · book-ipcn67-71 — RATTER, J. 1969. Cytogenetic Studies in spergularia IV. Notes Royal Bot. Gard. Edinburgh 29: 213-224.
CCDB · book-northern-plants — Nordenskiiild (L. & L. 1942 b).
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · book-ipcn73-74 — FRITSCH, R.M. 1973. In IOPB chromosome number reports XLI. Taxon 459-464.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — NordenskiOld (LOve, A. & Uive, D. 1942b) ; Ratter, J.A. 1959
CCDB · book-fedorov — Nordenskiold (LOve
CCDB · book-fedorov — A .. Lovo D. 1942b)
CCDB · book-fedorov — Rat.ter 1959a (L. 1961)
CCDB · book-atlas-flowering-plants — L. & L. 1942
CCDB · Cave1957 — Blackburn & Morton
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Dvorak, F. & Dadakova, B. (1984). Chromosome counts and chromosome morphology of some selected species. Folia Geobot. Phytotax. (Bohem.) 19: 41-70.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974a). Cytotaxonomy of Spanish plants III. Dycotiledons: Salicaceae-Rosaceae. Lagascalia 4(1): 3-32.
CCDB · CromoCat 2015 — Májovsky, J. (1974a). Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 22: 1-20.
CCDB · CromoCat 2015 — Dvorák, F., Grüll, F., Kurka, R., Ruzicka, I. & Dadáková, B. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 544.
CCDB · CromoCat 2015 — Dvorák, F., Grüll, F., Ruzicka, J. & Dadáková, B. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 391-392.
CCDB · CromoCat 2015 — Fritsch, R. M. (1973b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLI]. Taxon 22(4): 460-461.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
CCDB · CromoCat 2015 — Dvo?ák, F. & Dadáková, B. (1984a). Chromosome counts and chromosome morphology of some selected species. Folia Geobot. Phytotax. 19: 41-70
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Petrova, A. (1995). Reports (415-434). Fl. Medit. 5: 279-288.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1983b). Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329-333.
CCDB · iapt — IAPT/IOPB Chromosome Data 27
2n 186×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. III. Caryophyllaceae Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 245: 143-176(1971).
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · book-ipcn67-71 — FERNANDES, A., & M.T. LEITAO. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal III. Cariophyllaceae. Bol. soc. Brot. 45 (ser. 2): 143-176.
CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1971). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. III. Caryophyllaceae. Bol. Soc. Brot. 45: 143-176.
CCDB · CromoCat 2015 — Kliphuis, E. & Barkoudah, Y. I. (1977). Chromosome numbers in some Syrian Angiosperms. Acta Bot. Neerl. 26: 239-249.
CCDB · iapt — IAPT/IOPB Chromosome Data 22
2n 271×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — RATTER, J. 1969. Cytogenetic Studies in spergularia IV. Notes Royal Bot. Gard. Edinburgh 29: 213-224.
2n 541×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 183×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · CromoCat 2015 — Mulligan, G. A. & A. E. Porsild. (1969). Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · CromoCat 2015 — Ratter, J. A. (1964). Cytogenetic studies in Spergularia, I. Cytology of some old world species. Notes Roy. Bot. Gard. Edinburgh 25(3): 293-302.
n 92×CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~9.76 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin9.76 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type111 309 records
Wild obs. + sensor100 414
Museum / vouchered10 637
Cultivated / captive20
Other238
Origin
Native7 624
Introduced3 165
Range
Area of Occupancy AOO217 636 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 24 987≤1 km 16 469≤10 km 47 569>10 km 621
89 646 georeferenced · 10 768 without coordinates
Open the mapobservation + sensor100 414
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 1 014≤1 km 2 103≤10 km 2 369>10 km 902
6 388 georeferenced · 4 249 without coordinates
Open the institutions mapphysical evidence10 637
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy6% within 1 km
≤100 m 1≤10 km 1>10 km 14
16 georeferenced · 4 without coordinates
Open the mapnot free-living20
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions176 of 313 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 873 |
| Helsinki, FI | 709 |
| Olocation not on record | 484 |
| LDlocation not on record | 345 |
| BRNUlocation not on record | 306 |
| BIO-UNIPIlocation not on record | 305 |
| BFLlocation not on record | 247 |
| South Kensington, GB | 247 |
| Moscow State Universitylocation not on record | 242 |
| Bergen, NO | 202 |
| Berlin, DE | 187 |
| Oulu, FI | 161 |
| MeiseBGlocation not on record | 155 |
| WTUlocation not on record | 148 |
| Museo Entomologico de Leonlocation not on record | 145 |
| KMNlocation not on record | 143 |
| Turku, FI | 126 |
| Brussel, BE | 124 |
| Canberra, AU | 107 |
| Oskarshamn, SE | 101 |
| Corvallis, US | 97 |
| Christchurch, NZ | 97 |
| Tartu, EE | 95 |
| Provincia di Livornolocation not on record | 93 |
| SLU Artdatabankenlocation not on record | 90 |
| Adelaide, AU | 83 |
| Pullman, US | 81 |
| Bronx, US | 78 |
| CICYTEXlocation not on record | 73 |
| Adam Mickiewicz University in Poznańlocation not on record | 73 |
| Riverside, US | 71 |
| MAlocation not on record | 70 |
| Görlitz, DE | 69 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 68 |
| Mount Annan, AU | 68 |
| TUR-Alocation not on record | 68 |
| Claremont, US | 66 |
| Victoria, CA | 65 |
| BDBClocation not on record | 64 |
| València, ES | 64 |
| BClocation not on record | 61 |
| Moscow, US | 61 |
| Salzburg, AT | 60 |
| Uniwersytet Warszawskilocation not on record | 56 |
| Acadia Universitylocation not on record | 53 |
| Durham, US | 52 |
| Trondheim, NO | 52 |
| Entomological Society of Latvialocation not on record | 51 |
| Vancouver, CA | 51 |
| Zürich, CH | 50 |
| College of the Atlantic, Museumlocation not on record | 50 |
| GZUlocation not on record | 49 |
| San Luis Obispo, US | 48 |
| Jyväskylä, FI | 47 |
| Zürich, CH | 46 |
| Davis, US | 46 |
| Arcata, US | 45 |
| Madison, US | 44 |
| Kensington, AU | 42 |
| Auckland, NZ | 42 |
| Wellington, NZ | 40 |
| Bern, CH | 39 |
| Hobart, AU | 39 |
| New Haven, US | 39 |
| DBF-NHMDlocation not on record | 36 |
| Burlington, US | 36 |
| Kuopio, FI | 36 |
| Brisbane, AU | 36 |
| Philadelphia, US | 35 |
| UIBlocation not on record | 35 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 34 |
| Missoula, US | 33 |
| Badajoz, ES | 33 |
| San Diego, US | 32 |
| Boise, US | 31 |
| Canadian Department of Agriculturelocation not on record | 31 |
| Philadelphia, US | 29 |
| Santa Barbara, US | 28 |
| Angwin, US | 28 |
| Denver, US | 24 |
| Barcelona, ES | 23 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 23 |
| Saint John, CA | 23 |
| Wlocation not on record | 23 |
| GJOlocation not on record | 23 |
| Chongqing Museumlocation not on record | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Uppsala, SE | 22 |
| Provo, US | 21 |
| Córdoba, ES | 21 |
| Uniwersytet Jagiellońskilocation not on record | 21 |
| Caldwell, US | 20 |
| Bozeman, US | 20 |
| PRClocation not on record | 20 |
| Vitoria, ES | 20 |
| Salamanca, ES | 18 |
| San Sebastián, ES | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 17 |
| Frankfurt am Main | 17 |
| CJBGlocation not on record | 17 |
| St. Paul, US | 17 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 17 |
| Montréal, CA | 16 |
| Porvoo, FI | 16 |
| Québec, CA | 16 |
| Pocatello, US | 16 |
| KIRMlocation not on record | 15 |
| Armidale, AU | 15 |
| Université Lavallocation not on record | 15 |
| Tallinn, EE | 15 |
| Odawara, JP | 15 |
| NSW Office of Environment and Heritagelocation not on record | 15 |
| CASlocation not on record | 14 |
| Mlocation not on record | 14 |
| JP | 14 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Cape Town, ZA | 13 |
| ISAlocation not on record | 13 |
| Tacoma, US | 13 |
| Madrid, ES | 13 |
| Green Bay, US | 12 |
| Paris, FR | 12 |
| Rotorua, NZ | 12 |
| Tsukuba, JP | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Portland, US | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Otaru, JP | 11 |
| Beijing, CN | 10 |
| US | 10 |
| Fukushima Universitylocation not on record | 10 |
| Logan, US | 10 |
| Ann Arbor, US | 9 |
| Pamplona, ES | 9 |
| Pamplona, ES | 9 |
| College Park, US | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 9 |
| Nagano City, JP | 9 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 9 |
| TROMlocation not on record | 9 |
| IDElocation not on record | 9 |
| Wuzhou, CN | 9 |
| University of Stellenboschlocation not on record | 9 |
| Kushiro City Museumlocation not on record | 9 |
| Santa Cruz, US | 8 |
| Irvine, US | 8 |
| Stockholm, SE | 8 |
| Tampa, US | 8 |
| Granada, ES | 8 |
| Fulda, DE | 8 |
| San Francisco, US | 7 |
| SZUlocation not on record | 7 |
| Flagstaff, US | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| nbflocation not on record | 7 |
| Bloomington, US | 6 |
| LfUlocation not on record | 6 |
| Ashland, US | 6 |
| Tilburg, NL | 6 |
| UChlocation not on record | 6 |
| Saint Louis, US | 6 |
| Orem, US | 6 |
| QVMAGlocation not on record | 6 |
| Sanda, JP | 6 |
| Tokushima, JP | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| BSBIlocation not on record | 5 |
| Kingston, US | 5 |
| Phoenix, US | 5 |
| Nunoa, Santiago, CL | 5 |
| QAUlocation not on record | 5 |
| Smithfield, AU | 5 |
| No collectionlocation not on record | 5 |
| Dresden, DE | 5 |
| Bourges, FR | 5 |
| San Jose, US | 5 |
| Anchorage, US | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Institute of the biological problems of the North FEB RASlocation not on record | 5 |
| Alicante, ES | 5 |
| KNFYlocation not on record | 5 |
| Bangkok, TH | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| H-Schuhwlocation not on record | 4 |
| Sion, CH | 4 |
| Kunming, CN | 4 |
| UGentlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| H-Adlerlocation not on record | 4 |
| Kew, GB | 4 |
| PrivatHerblocation not on record | 4 |
| Forssa, FI | 4 |
| Batemans Bay, AU | 4 |
| Whitehorse, CA | 4 |
| Northridge, US | 3 |
| Dekalb, US | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| Pretoria, ZA | 3 |
| Philadelphia, US | 3 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 3 |
| Rishon Le Zion, IL | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Sendai, JP | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Porrentruy, CH | 3 |
| Pittsburg, US | 3 |
| Toyama, JP | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Fort Bragg, US | 3 |
| ASUlocation not on record | 3 |
| Durango, US | 3 |
| Keene State Universitylocation not on record | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| H-AkrKGlocation not on record | 2 |
| Göteborg, SE | 2 |
| Staten Island, US | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Parkville, AU | 2 |
| Wollongong, AU | 2 |
| Chadron, US | 2 |
| Lausanne, CH | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Weber State Universitylocation not on record | 2 |
| Bando, JP | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| CJBNlocation not on record | 2 |
| JBSlocation not on record | 2 |
| Namur, BE | 2 |
| University of Wisconsinlocation not on record | 2 |
| KR | 2 |
| DULlocation not on record | 2 |
| US | 2 |
| BGPAlocation not on record | 2 |
| Davenport, US | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| GMBAlocation not on record | 2 |
| SEFlocation not on record | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Kiritappu Wetland National Trustlocation not on record | 2 |
| Little Rock, US | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Albuquerque, US | 2 |
| EL PASO, US | 2 |
| H-Hohlalocation not on record | 2 |
| Madrid, ES | 1 |
| Kochi, JP | 1 |
| JBRJlocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Umeå Universitylocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Grand Junction, US | 1 |
| Xiamen, CN | 1 |
| Whitewater, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Boumlocation not on record | 1 |
| US | 1 |
| SNSNMClocation not on record | 1 |
| Bend, US | 1 |
| Podgorica, ME | 1 |
| University of South Dakotalocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| ESP109location not on record | 1 |
| STNFlocation not on record | 1 |
| Cambridge, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Edinburgh, GB | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| San Bernardino, US | 1 |
| Nishihara, JP | 1 |
| FLASlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Brookings, US | 1 |
| KNFHClocation not on record | 1 |
| Henderson, US | 1 |
| Sevilla, ES | 1 |
| Chiba, JP | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| Toronto, CA | 1 |
| Truckee, US | 1 |
| University of British Columbialocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| New Brunswick, US | 1 |
| BioFokuslocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Sagamihara, JP | 1 |
| Jackson, US | 1 |
| Yangling, CN | 1 |
| Rovaniemi, FI | 1 |
| Columbia, US | 1 |
| Taipei, TW | 1 |
| Monastir, TN | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| ESP003location not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Portland, US | 1 |
313 institutions · 9 990 of 10 637 vouchered records shown · 590 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Spergularia rubra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map6 countries0
Wet forest, Subalpine fir/Globe huckleberry-…on cliff ledgeWetland vegetation and disturbed area with R…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 8.40–17.4
Seasonal swing summer↔winter15.2 °C
Max temp (day)18.8 °C 11.8–21.6
Min temp (night)11.2 °C 4.20–13.5
Precipitation75.6 mm/mo 53.5–94.7
Air humidity61.9 % 56.6–65.5
Moisture balance-31.0 mm/mo -76.9–30.3
Vapour deficit603 Pa 396–798
Wind speed3.60 m/s 1.40–5.30
Cloud cover47.3 % 29.7–53.9
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.